ID: 1047275477

View in Genome Browser
Species Human (GRCh38)
Location 8:123402047-123402069
Sequence ATGTCGGCCCAGATTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047275470_1047275477 26 Left 1047275470 8:123401998-123402020 CCTTTGGTCCATGATGTACTCAG 0: 4
1: 4
2: 2
3: 7
4: 151
Right 1047275477 8:123402047-123402069 ATGTCGGCCCAGATTGAGGGTGG No data
1047275472_1047275477 18 Left 1047275472 8:123402006-123402028 CCATGATGTACTCAGGAGAGCTC 0: 6
1: 4
2: 2
3: 8
4: 101
Right 1047275477 8:123402047-123402069 ATGTCGGCCCAGATTGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047275477 Original CRISPR ATGTCGGCCCAGATTGAGGG TGG Intronic
No off target data available for this crispr