ID: 1047275477 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:123402047-123402069 |
| Sequence | ATGTCGGCCCAGATTGAGGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1047275470_1047275477 | 26 | Left | 1047275470 | 8:123401998-123402020 | CCTTTGGTCCATGATGTACTCAG | 0: 4 1: 4 2: 2 3: 7 4: 151 |
||
| Right | 1047275477 | 8:123402047-123402069 | ATGTCGGCCCAGATTGAGGGTGG | No data | ||||
| 1047275472_1047275477 | 18 | Left | 1047275472 | 8:123402006-123402028 | CCATGATGTACTCAGGAGAGCTC | 0: 6 1: 4 2: 2 3: 8 4: 101 |
||
| Right | 1047275477 | 8:123402047-123402069 | ATGTCGGCCCAGATTGAGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1047275477 | Original CRISPR | ATGTCGGCCCAGATTGAGGG TGG | Intronic | ||
| No off target data available for this crispr | |||||