ID: 1047283255

View in Genome Browser
Species Human (GRCh38)
Location 8:123464250-123464272
Sequence CAATGGATGCAGGTTGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047283252_1047283255 -8 Left 1047283252 8:123464235-123464257 CCTAAAGGGACCAGTCAATGGAT No data
Right 1047283255 8:123464250-123464272 CAATGGATGCAGGTTGCCCCTGG No data
1047283245_1047283255 25 Left 1047283245 8:123464202-123464224 CCTTCTGGAGCAAGGAGGCTGGG No data
Right 1047283255 8:123464250-123464272 CAATGGATGCAGGTTGCCCCTGG No data
1047283243_1047283255 26 Left 1047283243 8:123464201-123464223 CCCTTCTGGAGCAAGGAGGCTGG No data
Right 1047283255 8:123464250-123464272 CAATGGATGCAGGTTGCCCCTGG No data
1047283251_1047283255 -7 Left 1047283251 8:123464234-123464256 CCCTAAAGGGACCAGTCAATGGA No data
Right 1047283255 8:123464250-123464272 CAATGGATGCAGGTTGCCCCTGG No data
1047283249_1047283255 -6 Left 1047283249 8:123464233-123464255 CCCCTAAAGGGACCAGTCAATGG No data
Right 1047283255 8:123464250-123464272 CAATGGATGCAGGTTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047283255 Original CRISPR CAATGGATGCAGGTTGCCCC TGG Intronic