ID: 1047286686

View in Genome Browser
Species Human (GRCh38)
Location 8:123493325-123493347
Sequence CTTTTGCACTGCCACGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047286683_1047286686 12 Left 1047286683 8:123493290-123493312 CCTACCATGGACAGAGGCTGACA No data
Right 1047286686 8:123493325-123493347 CTTTTGCACTGCCACGTATCTGG No data
1047286684_1047286686 8 Left 1047286684 8:123493294-123493316 CCATGGACAGAGGCTGACACCGC No data
Right 1047286686 8:123493325-123493347 CTTTTGCACTGCCACGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047286686 Original CRISPR CTTTTGCACTGCCACGTATC TGG Intergenic
No off target data available for this crispr