ID: 1047286757

View in Genome Browser
Species Human (GRCh38)
Location 8:123493872-123493894
Sequence CAGCCCCAGTGTAACATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047286757_1047286764 18 Left 1047286757 8:123493872-123493894 CCATAAATGTTACACTGGGGCTG No data
Right 1047286764 8:123493913-123493935 TGTAATCCTAGCACTTCGGGAGG 0: 446
1: 28088
2: 322696
3: 263272
4: 201362
1047286757_1047286762 15 Left 1047286757 8:123493872-123493894 CCATAAATGTTACACTGGGGCTG No data
Right 1047286762 8:123493910-123493932 GCCTGTAATCCTAGCACTTCGGG 0: 433
1: 21299
2: 249339
3: 281774
4: 265084
1047286757_1047286766 27 Left 1047286757 8:123493872-123493894 CCATAAATGTTACACTGGGGCTG No data
Right 1047286766 8:123493922-123493944 AGCACTTCGGGAGGCCAAGATGG 0: 73
1: 5182
2: 69671
3: 157107
4: 157734
1047286757_1047286761 14 Left 1047286757 8:123493872-123493894 CCATAAATGTTACACTGGGGCTG No data
Right 1047286761 8:123493909-123493931 TGCCTGTAATCCTAGCACTTCGG 0: 7892
1: 107752
2: 241468
3: 240344
4: 208055
1047286757_1047286767 28 Left 1047286757 8:123493872-123493894 CCATAAATGTTACACTGGGGCTG No data
Right 1047286767 8:123493923-123493945 GCACTTCGGGAGGCCAAGATGGG 0: 45
1: 2884
2: 41111
3: 148461
4: 241548

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047286757 Original CRISPR CAGCCCCAGTGTAACATTTA TGG (reversed) Intergenic
No off target data available for this crispr