ID: 1047286761

View in Genome Browser
Species Human (GRCh38)
Location 8:123493909-123493931
Sequence TGCCTGTAATCCTAGCACTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 805511
Summary {0: 7892, 1: 107752, 2: 241468, 3: 240344, 4: 208055}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047286757_1047286761 14 Left 1047286757 8:123493872-123493894 CCATAAATGTTACACTGGGGCTG No data
Right 1047286761 8:123493909-123493931 TGCCTGTAATCCTAGCACTTCGG 0: 7892
1: 107752
2: 241468
3: 240344
4: 208055

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047286761 Original CRISPR TGCCTGTAATCCTAGCACTT CGG Intergenic
Too many off-targets to display for this crispr