ID: 1047286762

View in Genome Browser
Species Human (GRCh38)
Location 8:123493910-123493932
Sequence GCCTGTAATCCTAGCACTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 817929
Summary {0: 433, 1: 21299, 2: 249339, 3: 281774, 4: 265084}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047286757_1047286762 15 Left 1047286757 8:123493872-123493894 CCATAAATGTTACACTGGGGCTG No data
Right 1047286762 8:123493910-123493932 GCCTGTAATCCTAGCACTTCGGG 0: 433
1: 21299
2: 249339
3: 281774
4: 265084

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047286762 Original CRISPR GCCTGTAATCCTAGCACTTC GGG Intergenic
Too many off-targets to display for this crispr