ID: 1047286764

View in Genome Browser
Species Human (GRCh38)
Location 8:123493913-123493935
Sequence TGTAATCCTAGCACTTCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 815864
Summary {0: 446, 1: 28088, 2: 322696, 3: 263272, 4: 201362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047286757_1047286764 18 Left 1047286757 8:123493872-123493894 CCATAAATGTTACACTGGGGCTG No data
Right 1047286764 8:123493913-123493935 TGTAATCCTAGCACTTCGGGAGG 0: 446
1: 28088
2: 322696
3: 263272
4: 201362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047286764 Original CRISPR TGTAATCCTAGCACTTCGGG AGG Intergenic
Too many off-targets to display for this crispr