ID: 1047286766

View in Genome Browser
Species Human (GRCh38)
Location 8:123493922-123493944
Sequence AGCACTTCGGGAGGCCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389767
Summary {0: 73, 1: 5182, 2: 69671, 3: 157107, 4: 157734}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047286757_1047286766 27 Left 1047286757 8:123493872-123493894 CCATAAATGTTACACTGGGGCTG No data
Right 1047286766 8:123493922-123493944 AGCACTTCGGGAGGCCAAGATGG 0: 73
1: 5182
2: 69671
3: 157107
4: 157734

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047286766 Original CRISPR AGCACTTCGGGAGGCCAAGA TGG Intergenic
Too many off-targets to display for this crispr