ID: 1047286767

View in Genome Browser
Species Human (GRCh38)
Location 8:123493923-123493945
Sequence GCACTTCGGGAGGCCAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 434049
Summary {0: 45, 1: 2884, 2: 41111, 3: 148461, 4: 241548}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047286757_1047286767 28 Left 1047286757 8:123493872-123493894 CCATAAATGTTACACTGGGGCTG No data
Right 1047286767 8:123493923-123493945 GCACTTCGGGAGGCCAAGATGGG 0: 45
1: 2884
2: 41111
3: 148461
4: 241548

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047286767 Original CRISPR GCACTTCGGGAGGCCAAGAT GGG Intergenic
Too many off-targets to display for this crispr