ID: 1047290575

View in Genome Browser
Species Human (GRCh38)
Location 8:123526176-123526198
Sequence CAAGCTGGTTATTATGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047290575 Original CRISPR CAAGCTGGTTATTATGATCT TGG (reversed) Intronic
906813479 1:48853055-48853077 TAAAATGTTTATTATGATCTAGG - Intronic
908403616 1:63793156-63793178 CGAGATGGGTATTATTATCTGGG + Intronic
908764755 1:67544443-67544465 CAAGCTGTATCTGATGATCTAGG + Intergenic
909695974 1:78468149-78468171 CCAGATGTTTATTATAATCTGGG - Intronic
912607511 1:111006992-111007014 CAAGCAGGGAATTATAATCTGGG - Intergenic
914950948 1:152112948-152112970 CAAGCTTGTTACTATGCTCTCGG - Exonic
917788540 1:178485216-178485238 CAAGGTGGTTAGGATGATGTAGG - Intergenic
922033268 1:221824894-221824916 CAAGGTGGGCATTAGGATCTGGG + Intergenic
923177002 1:231476286-231476308 CAGGGTGGTTACTATGTTCTTGG + Intergenic
923193860 1:231645417-231645439 AAAGCTGGATATTATCATTTGGG - Intronic
923929368 1:238676184-238676206 CAAGCAGCGTATGATGATCTTGG + Intergenic
1070426564 10:76294064-76294086 CAAGCTGGGTGTTCTGATATTGG + Intronic
1074145773 10:110715984-110716006 CAAGCTTTTGATTATGTTCTTGG + Intronic
1074422480 10:113321708-113321730 AAAGCTGGTGATTAGGATTTGGG + Intergenic
1074495736 10:113978780-113978802 CAAGCTGGATAAAATGAACTTGG - Intergenic
1084095566 11:66908928-66908950 AAAGCTGCTTATTGTCATCTTGG - Intronic
1097477325 12:60074261-60074283 CCAGCTGCTTATTATGCCCTGGG + Intergenic
1101797737 12:107991460-107991482 CTAGGTGGTTCTTATTATCTTGG + Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1106211715 13:27654566-27654588 CTAGCTGGTTATTCAGATGTGGG - Intronic
1108410521 13:50141909-50141931 CAAGCTGGTTTTTCTTATCCTGG - Intronic
1109711188 13:66162730-66162752 TTAGCTGGGTATTATGATGTGGG - Intergenic
1110673712 13:78212688-78212710 CAAGCAACTTATTATGTTCTGGG + Intergenic
1112825465 13:103387535-103387557 CAACTTGTTTATTATGATCTAGG - Intergenic
1115336821 14:32250462-32250484 GAAGCTGGTGATCATGAGCTGGG - Intergenic
1115794703 14:36921716-36921738 CAAGGTGCTGATTATGTTCTGGG + Intronic
1119206388 14:72797288-72797310 CTAGCTGGTTCTTCTGATTTGGG - Intronic
1119927727 14:78512247-78512269 CTGGCTGGTTCTTCTGATCTAGG - Intronic
1122817714 14:104321757-104321779 CAAGCAGGCTGTTAGGATCTAGG - Intergenic
1123881689 15:24682392-24682414 CAAGCTAAATATTATGATCCTGG + Exonic
1135984602 16:27174821-27174843 CAAGATGGGTCTTATCATCTTGG + Intergenic
1138856690 16:60702172-60702194 CAATCTGATTATTATGCTTTGGG - Intergenic
1139330921 16:66189339-66189361 CAAGCTGGTGGGTTTGATCTCGG - Intergenic
1154463271 18:14617841-14617863 TAAGCTGGTTTTTATGGTATGGG + Intergenic
1155619336 18:27758776-27758798 CAAGGTGGTTATGAACATCTTGG - Intergenic
1155931557 18:31714319-31714341 CAAGCTGGTGATCATGATGGAGG - Intergenic
1157527312 18:48393737-48393759 CAGGTTGGTTATGATTATCTTGG - Intronic
930144477 2:47987387-47987409 CAATCTGGGGAGTATGATCTGGG - Intergenic
931339839 2:61389681-61389703 CAATTTGGTTTTTATGATGTTGG - Intronic
934631213 2:95925159-95925181 CAAGCTTGTTACTAAGATCATGG + Intronic
934802832 2:97183825-97183847 CAAGCTTGTTACTAAGATCATGG - Intronic
938698988 2:133859584-133859606 CAGGCTGGTTTTTGTGATTTGGG - Intergenic
940628500 2:156207957-156207979 GAAGCTGTATATTATGATTTGGG - Intergenic
941536223 2:166725009-166725031 GAAGTTTGTTATTATGAGCTAGG + Intergenic
941934411 2:170971995-170972017 CAATGGGGTTATTTTGATCTAGG + Intergenic
944611853 2:201418176-201418198 CAAGCTGGTTATTATTATTAGGG + Intronic
1170915776 20:20623994-20624016 TTAGCTGGGTATAATGATCTTGG - Intronic
1171102526 20:22398853-22398875 CAACCTGGTTATTCTGATGTGGG - Intergenic
1172806447 20:37615350-37615372 CAAACAGGTCATTATAATCTGGG - Intergenic
1173173856 20:40749274-40749296 CAAGCTGGTTAACATCATGTTGG + Intergenic
1176811252 21:13540532-13540554 TAAGCTGGTTTTTATGGTATGGG - Intergenic
1177522804 21:22251398-22251420 AAAGCTGCTAATTATGAGCTGGG + Intergenic
1178221434 21:30664816-30664838 CATGGTGATTATTATTATCTTGG + Intergenic
1178349119 21:31859146-31859168 CAAGCTGGAATGTATGATCTCGG + Intergenic
1184178404 22:42802977-42802999 CAAACTTGTTCTTATAATCTTGG - Intronic
952524563 3:34196659-34196681 CATTCTGGTGAATATGATCTAGG - Intergenic
953085837 3:39666078-39666100 CAACCTGGTAAAGATGATCTGGG + Intergenic
955620080 3:60854026-60854048 CAACCTGGGTATTATGTTTTAGG - Intronic
959138608 3:102456348-102456370 CAAGCTGGGTATTATTAACCAGG - Exonic
959383406 3:105670881-105670903 CAAGGTGCTTATTATTATATTGG + Intronic
959485057 3:106918741-106918763 CATGCTGGGTTTTATTATCTAGG - Intergenic
963948036 3:151167963-151167985 TAAGGTGGTTATGATAATCTTGG - Intronic
973256495 4:48118534-48118556 CAAGCTGCTTATCGTGAGCTGGG - Intronic
973561593 4:52142394-52142416 AATTGTGGTTATTATGATCTGGG + Intergenic
975271834 4:72444329-72444351 CAACCTGTTTTTTATGATCTTGG - Intronic
978096090 4:104780289-104780311 CATGCTTGTTATCAGGATCTTGG + Intergenic
979382805 4:120028287-120028309 GCAGCTGGTTGTTATGATGTGGG + Intergenic
985335960 4:188894873-188894895 CATGATGGTTATCATGAGCTGGG + Intergenic
986403551 5:7402838-7402860 CAAGGTGGTCATTATTTTCTGGG + Intronic
986962749 5:13235291-13235313 AAAGATTGTTATTTTGATCTTGG - Intergenic
989453320 5:41612495-41612517 AAAGCAGGTTATTACGAACTGGG - Intergenic
994761747 5:103862629-103862651 CAAGGTGGTTATGCTTATCTAGG - Intergenic
1004433260 6:15565650-15565672 AAAGCTGGTTATGCTTATCTGGG + Intronic
1008098180 6:47361523-47361545 AAACCTGTTTATAATGATCTGGG - Intergenic
1011054272 6:83189269-83189291 CAAGCTGGCTAGTGTGTTCTTGG - Intronic
1014496697 6:122133240-122133262 CAAGCTAGTTGTTATGAGATTGG + Intergenic
1015061907 6:128976388-128976410 CTAGCTGGTGATAATGATTTGGG + Intronic
1020500799 7:8917693-8917715 AAATCTGGGTATTTTGATCTTGG + Intergenic
1020510588 7:9051671-9051693 CAGGCTGGCTACTATGGTCTGGG + Intergenic
1021021380 7:15602353-15602375 CAGGCTGCTAATTATGCTCTGGG - Intergenic
1023931724 7:44710213-44710235 CAAACTGGTTCTGAGGATCTAGG + Intergenic
1030727867 7:112947266-112947288 CATGGTGCTTATTATGTTCTAGG + Intergenic
1031838338 7:126705899-126705921 CAAGCTATTTATTATGTTATGGG + Intronic
1036626293 8:10474980-10475002 CCAGCTGGGTATTATCAGCTGGG - Intergenic
1046727250 8:117689389-117689411 CAATTTGGGAATTATGATCTTGG + Intergenic
1047290575 8:123526176-123526198 CAAGCTGGTTATTATGATCTTGG - Intronic
1048385001 8:133904155-133904177 CAACCTGGTTACTCTGTTCTGGG - Intergenic
1050876155 9:10639467-10639489 AAAGCTGCTTATTATGTTCTCGG - Intergenic
1051462825 9:17342647-17342669 GAAACTGGATAATATGATCTAGG + Intronic
1053546454 9:39027816-39027838 AAAACTGGTTAATATTATCTAGG - Intergenic
1054753987 9:68938640-68938662 CTAGCTGGTTGTTTTGAGCTGGG + Intronic
1059969440 9:119650041-119650063 TAAAATGGTTATTATGATTTTGG + Intergenic
1193486438 X:82090034-82090056 CAAGCTGGTAGTAATTATCTTGG - Intergenic
1195706103 X:107738974-107738996 CAAGCTGTTTATTGTGGTCTTGG + Intronic