ID: 1047292176

View in Genome Browser
Species Human (GRCh38)
Location 8:123540757-123540779
Sequence GACCCGGAGGGTGGGACTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047292176 Original CRISPR GACCCGGAGGGTGGGACTAC GGG (reversed) Intronic
900375251 1:2351289-2351311 GAAATGGAGGGTGAGACTACAGG + Intronic
900966813 1:5964566-5964588 GGCCGGGAGGGTGGGACTCCAGG - Intronic
900976577 1:6020523-6020545 GTCCAGGAGGGTGGGGCTTCGGG - Intronic
903224996 1:21889622-21889644 GACCCGGAGGCTGGAAATAAAGG + Intronic
904237701 1:29124979-29125001 GACCCAGAGGGTGGGAGCTCAGG - Intergenic
905796302 1:40818434-40818456 GACCCGGAGGCGGGGACTTCTGG - Intronic
910079338 1:83322566-83322588 CTCCTGGAGAGTGGGACTACAGG - Intergenic
916749812 1:167713955-167713977 GTCCTGGAGGGTGGGACAACTGG - Intergenic
918905520 1:190487466-190487488 CAACCGGAGGTTGGGACCACAGG - Intergenic
920839798 1:209544997-209545019 GTGCCTGAGGGTGGGAATACAGG - Intergenic
922894091 1:229087598-229087620 GAGCCAGAGGGTGGGACTCTTGG + Intergenic
923539359 1:234877080-234877102 GCCCCGTATGGTGGGATTACAGG + Intergenic
1066703684 10:38156490-38156512 AGCCCGGAGGGTGGGACCCCAGG + Intergenic
1071428216 10:85580884-85580906 GACCCTGAGGCAGGGCCTACAGG - Intergenic
1077021204 11:417846-417868 GACCCGGAGTGTGGAACGTCTGG - Intergenic
1081893640 11:46566292-46566314 GCCCCGGTAGCTGGGACTACAGG - Intronic
1084675370 11:70630927-70630949 GCGCCGGAGGGAGGGACCACAGG - Intronic
1084910151 11:72381685-72381707 GACCTGGAGGCTGGGTCTGCTGG - Intronic
1084972422 11:72779087-72779109 GACACAGAGGGTGGGAGTACTGG + Intronic
1088592514 11:111415685-111415707 GCCCTGGAGGCTGGGCCTACGGG + Intronic
1089340935 11:117756942-117756964 GACCTGGAGGATGGGACACCAGG + Intronic
1089462146 11:118659626-118659648 GACCCGCAGGCTGGGACAAGGGG + Intronic
1089590479 11:119537202-119537224 GGCGGGGAAGGTGGGACTACAGG - Intergenic
1096991929 12:55811440-55811462 CACCCAGTAGGTGGGACTACAGG - Intronic
1100461136 12:94800403-94800425 GACCTGTTGGGTGGGTCTACTGG + Intergenic
1103691923 12:122782074-122782096 TCCCCAGAGGCTGGGACTACAGG - Intronic
1103918931 12:124389563-124389585 GACACGGAGGGTGGGGGGACGGG - Intronic
1112481744 13:99782381-99782403 CCTCCTGAGGGTGGGACTACAGG - Intronic
1113895136 13:113759365-113759387 GACCCCGGGGCTGGGACTACAGG + Intronic
1114355918 14:21907940-21907962 AGCCCTGAGGGTGGGGCTACAGG + Intergenic
1117399161 14:55342642-55342664 GACCAGGAGGGTGTGAATATAGG - Intronic
1126759152 15:51953495-51953517 CTCCCGAAGGCTGGGACTACAGG - Intronic
1132653603 16:1032366-1032388 GACCTGGGGGGTGGTTCTACAGG - Intergenic
1133675051 16:8063353-8063375 CACCGGGAGGGTGGGGCTAGAGG + Intergenic
1133753352 16:8742296-8742318 GAACCGGAGTGTGGAAATACTGG - Intronic
1134173433 16:11987186-11987208 CCCCAGGAGGCTGGGACTACAGG + Intronic
1136355727 16:29744133-29744155 GACCCGGGGAGGGGGACTCCAGG + Exonic
1136512518 16:30748126-30748148 GACCCGGAAGTTGGGTTTACTGG - Intergenic
1136632311 16:31496177-31496199 GAGCTCGAGGCTGGGACTACAGG + Intronic
1141566110 16:84903195-84903217 GACCCGGAAGGTGGGAGGAGGGG - Intronic
1142684626 17:1570807-1570829 GACCCGCATGGTGGGACGCCTGG - Intronic
1143487504 17:7262735-7262757 GACTCGGAGCTTGGGACTCCTGG - Intronic
1144876224 17:18398861-18398883 GAGCCGGAGGGTGTGGCTCCAGG - Intergenic
1147902814 17:43800796-43800818 GACCCAGAGTGTGGGCCTAATGG - Intronic
1149268253 17:54951293-54951315 TACCTGGAGGGTGGGACTCCAGG - Intronic
1151793527 17:76325726-76325748 CACCCGGTAGCTGGGACTACAGG + Intronic
1152204709 17:78968336-78968358 GACCTGGAGGCAGGGACTTCCGG - Intergenic
1152256470 17:79242868-79242890 GACCTTGAAGGTGGGACTCCAGG - Intronic
1152537406 17:80958917-80958939 GACCCAGAGGAAGGGAATACTGG - Intronic
1155974140 18:32109760-32109782 TACCCAGTAGGTGGGACTACAGG - Intronic
1160406764 18:78651732-78651754 AACCCTGAGGATGGGACTGCAGG + Intergenic
1161193499 19:2972860-2972882 GCCCAGGAGGTTGGGACTGCAGG + Intergenic
1162492098 19:10998977-10998999 GTCCAGGAGGTTGAGACTACAGG - Intronic
1165093869 19:33400249-33400271 GACCCAGATGGAGGGACTCCAGG + Intronic
1165386557 19:35513586-35513608 GACCCAGAGGGAGGGAGGACAGG - Exonic
1166680839 19:44765673-44765695 TCCCCAGTGGGTGGGACTACAGG - Intergenic
1167870176 19:52362285-52362307 GCCCCAGTGGCTGGGACTACAGG - Intronic
1168613963 19:57822810-57822832 GGCCAGGAAGGTGTGACTACAGG + Intronic
1168625354 19:57913827-57913849 GGCCAGGAAGGTGTGACTACAGG - Intronic
928215378 2:29356956-29356978 GCCCCAGAGGGTGGGACTTGGGG - Intronic
931357966 2:61553600-61553622 TACCCAGCAGGTGGGACTACTGG - Intergenic
932811977 2:74833789-74833811 GACCCGGGGTGTGGGGCGACTGG - Intergenic
934644287 2:96049437-96049459 GACCTGGAGGGAGGCACTTCTGG - Intergenic
934690904 2:96358390-96358412 GACCCCGAGGCTGGGATTAAGGG + Intronic
937936966 2:127253805-127253827 GACCCAGTAGCTGGGACTACAGG - Intergenic
942234959 2:173895104-173895126 TCCCAAGAGGGTGGGACTACAGG + Intergenic
944512149 2:200475418-200475440 GTCCAGAAAGGTGGGACTACTGG + Intronic
945855466 2:215064311-215064333 GACCCGGAGAGTGGTAATCCAGG - Intronic
1171495649 20:25553224-25553246 GCCCAAGTGGGTGGGACTACAGG + Intronic
1173613680 20:44388933-44388955 GACCCGAGGGGTGGGGCTGCGGG + Intronic
1173734355 20:45348615-45348637 CTCCCGGAGGGTAGGACTAGGGG - Intergenic
1174480643 20:50828850-50828872 TACCAGGAGGGTGAGACCACGGG + Intronic
1178491475 21:33055370-33055392 GACCCTGAGGGTGGGAAGTCTGG + Intergenic
1180382992 22:12158070-12158092 TCCCAGGAGGCTGGGACTACAGG - Intergenic
1181790359 22:25260833-25260855 GGCTGGGAGGCTGGGACTACAGG + Intergenic
1181826170 22:25517845-25517867 GGCTGGGAGGCTGGGACTACAGG + Intergenic
1185108104 22:48885578-48885600 GACCCAGGGGCTGGGACTCCCGG - Intergenic
949517342 3:4819684-4819706 AACCCGGAGGAAGGGACTTCTGG + Intronic
950316593 3:12006149-12006171 GACCCAGAGGGAGGGAGTGCTGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
953432198 3:42849376-42849398 GGCCCGGTGGCTGGGATTACAGG - Intronic
954930246 3:54275009-54275031 GACCAGGAGGCAGGGACCACTGG + Intronic
957665446 3:83218996-83219018 GTCCTGGAGGGTGGGGCTCCTGG + Intergenic
962877581 3:139547396-139547418 AACCCGGATAGTGGGACTAAGGG + Intergenic
966788828 3:183646236-183646258 GTCCAAGCGGGTGGGACTACAGG - Intronic
966911234 3:184561598-184561620 GACCCCGAGGGTGGGCCTGGCGG + Intronic
967228916 3:187319276-187319298 GAGCTGTAGGGTGGGAGTACTGG - Intergenic
968518496 4:1024721-1024743 CACCCGGTGGGTGGGACGCCGGG - Intronic
971308008 4:25500702-25500724 GGCCAGGAGCTTGGGACTACCGG - Intergenic
974924789 4:68283518-68283540 GCCCCAGTGGCTGGGACTACAGG - Intergenic
975665180 4:76728046-76728068 GAGTAGGAGGCTGGGACTACAGG - Intronic
978339470 4:107707137-107707159 AGCCTGGAGGGTGGGGCTACAGG + Intronic
980105653 4:128585733-128585755 CACCCGGTAGCTGGGACTACAGG - Intergenic
981630482 4:146813388-146813410 GACCCGGAGGGTAGGATGAGTGG + Intronic
983430983 4:167650906-167650928 CTCCCGGGGGCTGGGACTACAGG - Intergenic
985614388 5:910793-910815 CACCAGGAGGGTGGGGCTGCAGG - Intronic
985995856 5:3596448-3596470 GCCCGGGAGGGAGAGACTACGGG + Intronic
987082457 5:14437814-14437836 TACCAGGATGGTGGGATTACGGG - Intronic
992758056 5:79927438-79927460 GACCTAGAGGGTGGGACTATTGG + Intergenic
993394687 5:87370536-87370558 TACCCAGTGGCTGGGACTACAGG - Intronic
1002198510 5:177513864-177513886 GACCCTGAGGTTGGGGCCACTGG + Intronic
1002305114 5:178278632-178278654 GCCCAGGAGGGTGGGAGGACTGG - Intronic
1002355426 5:178625312-178625334 GTCCCAGTAGGTGGGACTACAGG - Intronic
1006368918 6:33632675-33632697 GAGCAGGAGGATGGGGCTACAGG - Intronic
1006825665 6:36933666-36933688 GAGGCTGAGGCTGGGACTACAGG - Intergenic
1007319044 6:41013193-41013215 GACCAGCCTGGTGGGACTACAGG - Intergenic
1014437026 6:121432037-121432059 TCCCGGGAGGCTGGGACTACAGG + Intergenic
1019660663 7:2222201-2222223 GTCCCACAGGCTGGGACTACAGG + Intronic
1019884370 7:3891222-3891244 GACCCGTAGGCTGGGAGTAGGGG + Intronic
1020007922 7:4792173-4792195 AGTCCGGAGGGTGGGACCACAGG - Intronic
1021539161 7:21737691-21737713 GACCAGGAGAGAGAGACTACTGG + Intronic
1021907345 7:25348389-25348411 GACTCGGAGGGAGGGACAGCTGG + Intergenic
1022014393 7:26336579-26336601 TCCCCGGTAGGTGGGACTACAGG - Intronic
1022155390 7:27656638-27656660 CACCTGGAGAGTTGGACTACTGG + Intronic
1023378276 7:39579919-39579941 TCCCAGGAGGCTGGGACTACAGG - Intronic
1026053030 7:66962738-66962760 GCCCAGGGAGGTGGGACTACAGG - Intergenic
1026252233 7:68681035-68681057 TACCAGGAAGCTGGGACTACAGG + Intergenic
1027297105 7:76787851-76787873 CTCCTGGAGAGTGGGACTACAGG - Intergenic
1027624319 7:80528458-80528480 AGCCTGGAGGGTGGGGCTACAGG - Intronic
1028346342 7:89788743-89788765 GGCCCGGGGGGTGGGACAAGGGG - Intergenic
1029083474 7:97993282-97993304 TCCCAGGAGGCTGGGACTACAGG + Intergenic
1029921585 7:104270213-104270235 GACCCAGAGGCTGCTACTACAGG + Intergenic
1032588921 7:133174619-133174641 TCCCAGGAGGCTGGGACTACAGG + Intergenic
1035078963 7:156200474-156200496 GACCTGGAGAGTGGCACTCCTGG - Intergenic
1036440033 8:8773744-8773766 TACCAGGAGGGAGGGACTGCTGG - Intergenic
1036707625 8:11056884-11056906 GACCTGAAGGGTGAGACTAGAGG - Intronic
1036989705 8:13578768-13578790 TACCTGGAGGGTGGGACACCTGG - Intergenic
1038744183 8:30242389-30242411 TACCAGGAGGCTGGGATTACTGG - Intergenic
1039067060 8:33617862-33617884 GGCCTGGAGGCTGGGTCTACAGG + Intergenic
1039830686 8:41211450-41211472 TCCCCAGTGGGTGGGACTACAGG + Intergenic
1040028898 8:42806463-42806485 TCCCCGGTGGTTGGGACTACAGG + Intergenic
1042269477 8:66940962-66940984 GACATGGAGGGAGGGACTGCAGG + Intergenic
1047292176 8:123540757-123540779 GACCCGGAGGGTGGGACTACGGG - Intronic
1052721441 9:32175584-32175606 GAGCAGGAGTGAGGGACTACAGG - Intergenic
1056592105 9:87972126-87972148 GCCCAGGAGGTTGAGACTACAGG + Intronic
1058235380 9:102484741-102484763 GACCTGGAAGCTGGGACTACAGG - Intergenic
1059664782 9:116436349-116436371 GACCCAGCAGGTGGGACTCCAGG + Intronic
1060511141 9:124233592-124233614 TACCCGGCAGCTGGGACTACAGG + Intergenic
1060970515 9:127734994-127735016 GACCCAGAGGGTGGGACCGAGGG - Intronic
1062453782 9:136626501-136626523 CACCTGCAGGGTGGGACTGCGGG + Intergenic
1062460874 9:136662086-136662108 GACCTGGAGGCTGGGACGCCGGG + Intronic
1186524038 X:10231607-10231629 GACCCAGAATGTGAGACTACTGG - Intronic
1189024665 X:37380425-37380447 GACCTGGAATGTGGTACTACAGG + Intronic
1189332234 X:40151382-40151404 GTCCCGGAGGGAGGGGCTCCAGG - Intronic
1192180864 X:68914730-68914752 GACCAGCAGTGTGGGACTCCTGG - Intergenic
1195927248 X:110038396-110038418 GGCATGGAGGGTGGGAGTACAGG - Intronic
1199610759 X:149610885-149610907 GACTAGGAGGGTGGGACAAGGGG + Intronic