ID: 1047292362

View in Genome Browser
Species Human (GRCh38)
Location 8:123541425-123541447
Sequence GCGGAGGTGCCAGGGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047292362_1047292370 -3 Left 1047292362 8:123541425-123541447 CCCGCCGCCCCTGGCACCTCCGC No data
Right 1047292370 8:123541445-123541467 CGCGCGCCCTCCCCGCCCCCAGG No data
1047292362_1047292382 24 Left 1047292362 8:123541425-123541447 CCCGCCGCCCCTGGCACCTCCGC No data
Right 1047292382 8:123541472-123541494 CGTTGTCCCAGAGCGAGGCCCGG No data
1047292362_1047292380 19 Left 1047292362 8:123541425-123541447 CCCGCCGCCCCTGGCACCTCCGC No data
Right 1047292380 8:123541467-123541489 GACACCGTTGTCCCAGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047292362 Original CRISPR GCGGAGGTGCCAGGGGCGGC GGG (reversed) Intergenic