ID: 1047294833

View in Genome Browser
Species Human (GRCh38)
Location 8:123561552-123561574
Sequence TTGTTATTATTTTGGAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047294833_1047294836 -7 Left 1047294833 8:123561552-123561574 CCTGGGTTCCAAAATAATAACAA No data
Right 1047294836 8:123561568-123561590 ATAACAATAACGTACTTAGTGGG No data
1047294833_1047294835 -8 Left 1047294833 8:123561552-123561574 CCTGGGTTCCAAAATAATAACAA No data
Right 1047294835 8:123561567-123561589 AATAACAATAACGTACTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047294833 Original CRISPR TTGTTATTATTTTGGAACCC AGG (reversed) Intergenic
No off target data available for this crispr