ID: 1047297590

View in Genome Browser
Species Human (GRCh38)
Location 8:123584925-123584947
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047297586_1047297590 24 Left 1047297586 8:123584878-123584900 CCATACACTACACGAAGAGGTCA No data
Right 1047297590 8:123584925-123584947 TGGGCTCTGACCAGTTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047297590 Original CRISPR TGGGCTCTGACCAGTTTGCC TGG Intergenic
No off target data available for this crispr