ID: 1047301762

View in Genome Browser
Species Human (GRCh38)
Location 8:123619484-123619506
Sequence TTCAGTATACAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047301762_1047301765 11 Left 1047301762 8:123619484-123619506 CCATTGTCCATTTGTATACTGAA No data
Right 1047301765 8:123619518-123619540 ATCATGTTCAGATTTAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047301762 Original CRISPR TTCAGTATACAAATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr