ID: 1047302020

View in Genome Browser
Species Human (GRCh38)
Location 8:123621710-123621732
Sequence TGTGGGGTCTTGACTGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047302020_1047302028 8 Left 1047302020 8:123621710-123621732 CCTGTTACAGTCAAGACCCCACA No data
Right 1047302028 8:123621741-123621763 TAGGACCTGGGTTAAAAGTTGGG No data
1047302020_1047302026 -4 Left 1047302020 8:123621710-123621732 CCTGTTACAGTCAAGACCCCACA No data
Right 1047302026 8:123621729-123621751 CACAGTTAGCAGTAGGACCTGGG No data
1047302020_1047302027 7 Left 1047302020 8:123621710-123621732 CCTGTTACAGTCAAGACCCCACA No data
Right 1047302027 8:123621740-123621762 GTAGGACCTGGGTTAAAAGTTGG No data
1047302020_1047302025 -5 Left 1047302020 8:123621710-123621732 CCTGTTACAGTCAAGACCCCACA No data
Right 1047302025 8:123621728-123621750 CCACAGTTAGCAGTAGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047302020 Original CRISPR TGTGGGGTCTTGACTGTAAC AGG (reversed) Intergenic
No off target data available for this crispr