ID: 1047302026

View in Genome Browser
Species Human (GRCh38)
Location 8:123621729-123621751
Sequence CACAGTTAGCAGTAGGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047302020_1047302026 -4 Left 1047302020 8:123621710-123621732 CCTGTTACAGTCAAGACCCCACA No data
Right 1047302026 8:123621729-123621751 CACAGTTAGCAGTAGGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047302026 Original CRISPR CACAGTTAGCAGTAGGACCT GGG Intergenic
No off target data available for this crispr