ID: 1047304250

View in Genome Browser
Species Human (GRCh38)
Location 8:123640234-123640256
Sequence CAGAAGGACATGGCCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047304250_1047304259 20 Left 1047304250 8:123640234-123640256 CCTGCTGGGGCCATGTCCTTCTG No data
Right 1047304259 8:123640277-123640299 GTAACTAGCTGGTCATGCCCTGG No data
1047304250_1047304256 9 Left 1047304250 8:123640234-123640256 CCTGCTGGGGCCATGTCCTTCTG No data
Right 1047304256 8:123640266-123640288 GACCCGATGCAGTAACTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047304250 Original CRISPR CAGAAGGACATGGCCCCAGC AGG (reversed) Intergenic
No off target data available for this crispr