ID: 1047304256

View in Genome Browser
Species Human (GRCh38)
Location 8:123640266-123640288
Sequence GACCCGATGCAGTAACTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047304250_1047304256 9 Left 1047304250 8:123640234-123640256 CCTGCTGGGGCCATGTCCTTCTG No data
Right 1047304256 8:123640266-123640288 GACCCGATGCAGTAACTAGCTGG No data
1047304253_1047304256 -1 Left 1047304253 8:123640244-123640266 CCATGTCCTTCTGCCAGGGAATG No data
Right 1047304256 8:123640266-123640288 GACCCGATGCAGTAACTAGCTGG No data
1047304248_1047304256 22 Left 1047304248 8:123640221-123640243 CCAGTGACTCTGTCCTGCTGGGG No data
Right 1047304256 8:123640266-123640288 GACCCGATGCAGTAACTAGCTGG No data
1047304245_1047304256 30 Left 1047304245 8:123640213-123640235 CCAGGATTCCAGTGACTCTGTCC No data
Right 1047304256 8:123640266-123640288 GACCCGATGCAGTAACTAGCTGG No data
1047304254_1047304256 -7 Left 1047304254 8:123640250-123640272 CCTTCTGCCAGGGAATGACCCGA No data
Right 1047304256 8:123640266-123640288 GACCCGATGCAGTAACTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047304256 Original CRISPR GACCCGATGCAGTAACTAGC TGG Intergenic
No off target data available for this crispr