ID: 1047304259

View in Genome Browser
Species Human (GRCh38)
Location 8:123640277-123640299
Sequence GTAACTAGCTGGTCATGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047304254_1047304259 4 Left 1047304254 8:123640250-123640272 CCTTCTGCCAGGGAATGACCCGA No data
Right 1047304259 8:123640277-123640299 GTAACTAGCTGGTCATGCCCTGG No data
1047304253_1047304259 10 Left 1047304253 8:123640244-123640266 CCATGTCCTTCTGCCAGGGAATG No data
Right 1047304259 8:123640277-123640299 GTAACTAGCTGGTCATGCCCTGG No data
1047304255_1047304259 -3 Left 1047304255 8:123640257-123640279 CCAGGGAATGACCCGATGCAGTA No data
Right 1047304259 8:123640277-123640299 GTAACTAGCTGGTCATGCCCTGG No data
1047304250_1047304259 20 Left 1047304250 8:123640234-123640256 CCTGCTGGGGCCATGTCCTTCTG No data
Right 1047304259 8:123640277-123640299 GTAACTAGCTGGTCATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047304259 Original CRISPR GTAACTAGCTGGTCATGCCC TGG Intergenic
No off target data available for this crispr