ID: 1047309314

View in Genome Browser
Species Human (GRCh38)
Location 8:123678215-123678237
Sequence GTGATCTTGAGTAAATGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047309312_1047309314 -5 Left 1047309312 8:123678197-123678219 CCCTGGTACTTTATGTGGGTGAT No data
Right 1047309314 8:123678215-123678237 GTGATCTTGAGTAAATGACCTGG No data
1047309313_1047309314 -6 Left 1047309313 8:123678198-123678220 CCTGGTACTTTATGTGGGTGATC No data
Right 1047309314 8:123678215-123678237 GTGATCTTGAGTAAATGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047309314 Original CRISPR GTGATCTTGAGTAAATGACC TGG Intergenic
No off target data available for this crispr