ID: 1047310049

View in Genome Browser
Species Human (GRCh38)
Location 8:123684372-123684394
Sequence CTAGCTCTCCAGAGCCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047310043_1047310049 17 Left 1047310043 8:123684332-123684354 CCTGAGAACTGCTCGACATGGTT 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1047310049 8:123684372-123684394 CTAGCTCTCCAGAGCCACAGAGG No data
1047310044_1047310049 -7 Left 1047310044 8:123684356-123684378 CCTCTGCGCCCCTCCACTAGCTC 0: 1
1: 0
2: 4
3: 26
4: 351
Right 1047310049 8:123684372-123684394 CTAGCTCTCCAGAGCCACAGAGG No data
1047310042_1047310049 18 Left 1047310042 8:123684331-123684353 CCCTGAGAACTGCTCGACATGGT 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1047310049 8:123684372-123684394 CTAGCTCTCCAGAGCCACAGAGG No data
1047310040_1047310049 19 Left 1047310040 8:123684330-123684352 CCCCTGAGAACTGCTCGACATGG 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1047310049 8:123684372-123684394 CTAGCTCTCCAGAGCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047310049 Original CRISPR CTAGCTCTCCAGAGCCACAG AGG Intronic
No off target data available for this crispr