ID: 1047319960

View in Genome Browser
Species Human (GRCh38)
Location 8:123769435-123769457
Sequence CTGGCCCTGACCACTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047319960_1047319963 11 Left 1047319960 8:123769435-123769457 CCTGGAAAAGTGGTCAGGGCCAG 0: 1
1: 0
2: 2
3: 28
4: 232
Right 1047319963 8:123769469-123769491 GCTTGTGTGCTTTGTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047319960 Original CRISPR CTGGCCCTGACCACTTTTCC AGG (reversed) Intronic
900266088 1:1757944-1757966 CTGACCCCGACCACTGTGCCCGG + Intronic
900869088 1:5289151-5289173 CTGGCCCTGCCTCCTCTTCCTGG + Intergenic
902415076 1:16233673-16233695 CTTGCCCACACCACTCTTCCCGG + Exonic
902610826 1:17596246-17596268 TTGGCCCTGGCCACTTGACCTGG - Intronic
905224378 1:36469619-36469641 CTGGCCCTGCCCAACTTTCCAGG + Intronic
905324902 1:37144994-37145016 CTGGCAATGTCCACTTTCCCTGG - Intergenic
906142168 1:43540316-43540338 CTGACCCTCCCCAATTTTCCAGG - Intronic
907388663 1:54142071-54142093 AGGGCCCTGACCACATTCCCTGG - Intronic
908816441 1:68040155-68040177 TTGGCCCTGACAACTTTTGCAGG - Intergenic
909093349 1:71255067-71255089 GTGGCCTAGACCACTTTTCTGGG + Intergenic
912953374 1:114135796-114135818 CTGGCCCTCACCCCTCTCCCTGG + Intronic
913430456 1:118785490-118785512 CAGGCCCTGATCACTTAGCCAGG + Intergenic
914756763 1:150566850-150566872 CTGCGCCTGGCCAATTTTCCTGG + Intergenic
915247252 1:154565233-154565255 CTGGACCTGTCCACTCTTCCTGG + Intergenic
915335236 1:155137039-155137061 CTGGCACTGCCACCTTTTCCAGG + Intronic
915432610 1:155878341-155878363 CTAGCCTTGCCCACCTTTCCAGG + Intronic
915508438 1:156372049-156372071 CTGGCCCTGACCCCTTCCCTTGG - Intronic
915607539 1:156962422-156962444 CTGGCTCTGAGCACTTTCCCCGG + Intronic
919697380 1:200591715-200591737 CTGGCCCTGACCGGTTATCAGGG - Intronic
920174152 1:204089714-204089736 CTGCCCCTGCCCTCTCTTCCGGG - Intronic
921900153 1:220441412-220441434 TTGGCCCTGATCCATTTTCCTGG - Intergenic
922076730 1:222252775-222252797 CTGGTCCTCACCACCTTTTCTGG - Intergenic
923148679 1:231215353-231215375 CTTGCCCTGTCTTCTTTTCCAGG + Exonic
924334008 1:242968563-242968585 CTGGCTCAAACAACTTTTCCAGG + Intergenic
1063766805 10:9151181-9151203 CTGGCCCTGCCCATTCTTCTGGG + Intergenic
1064739648 10:18419601-18419623 CTGGACAAGACCCCTTTTCCAGG - Intronic
1065359746 10:24878375-24878397 CTGACCCTCACCAGTATTCCTGG + Intronic
1067287763 10:44920009-44920031 CTGGCGGTGACCACCTCTCCTGG + Intronic
1067451624 10:46385269-46385291 CTGGCCCTGTCCACTCTGCCAGG - Intronic
1067538661 10:47135862-47135884 CTGGCCAGGACTACGTTTCCTGG + Intergenic
1067585615 10:47474487-47474509 CTGGCCCTGTCCACTCTGCCAGG + Intronic
1068698012 10:59989830-59989852 CAGGCCCATTCCACTTTTCCTGG + Intergenic
1068825824 10:61437640-61437662 CAGGCCCAGACCACTCTGCCTGG - Intronic
1069261609 10:66404897-66404919 CTGCCCCTAACCATTTTTCATGG - Intronic
1070600793 10:77865003-77865025 CTAGTCCAGAGCACTTTTCCTGG + Intronic
1072998472 10:100267395-100267417 CCGGGGCTGACCTCTTTTCCTGG - Intronic
1074112439 10:110432014-110432036 CTAGCCCTGTCCCCTTTCCCAGG - Intergenic
1076851682 10:133096382-133096404 CTGACCCTGAACCCTTTTCTTGG + Intronic
1077209198 11:1360619-1360641 CTGGTCCTGTCCTCTTGTCCAGG + Intergenic
1077324340 11:1957229-1957251 CCTGCCCTAACCACCTTTCCAGG - Intronic
1077353877 11:2105758-2105780 CAGGACCTGACCACTTGCCCAGG + Intergenic
1078526696 11:12106837-12106859 CTTCCCCAGGCCACTTTTCCAGG - Intronic
1078558506 11:12350924-12350946 CTTGCCCTTTCCACTTTTTCTGG + Intronic
1078649594 11:13176133-13176155 CTGGCACTCACCAGTTTCCCTGG + Intergenic
1080261920 11:30358784-30358806 CTGGCCCTGCCTTCTTTGCCTGG + Intergenic
1083667426 11:64283539-64283561 CTGCCCCTGGCCACTGTGCCAGG + Intronic
1083698439 11:64457911-64457933 CTGGCCCAGACCCCTTCACCTGG + Intergenic
1083969820 11:66068126-66068148 CAGGCCCTGATCTCCTTTCCAGG + Exonic
1084024131 11:66437339-66437361 CTGGCCCTCACCTGTTTGCCGGG + Exonic
1084218451 11:67664098-67664120 CTGTCCCTGACCTCCATTCCGGG + Intronic
1086860744 11:91922185-91922207 GCTGCCCTGACCCCTTTTCCTGG - Intergenic
1088701866 11:112420334-112420356 ATGGACATGACCAATTTTCCTGG - Intergenic
1088907495 11:114165664-114165686 CTGGCACTGACCCCTTTCCTGGG - Intronic
1090522771 11:127496695-127496717 CTGGACATGAGGACTTTTCCTGG - Intergenic
1091217171 11:133909165-133909187 CTCGTCCTGACCCCTTTGCCCGG - Exonic
1091297151 11:134482055-134482077 CTGTCACTGAGCACTTTTCGTGG + Intergenic
1202807321 11_KI270721v1_random:12406-12428 CCTGCCCTAACCACCTTTCCAGG - Intergenic
1091680829 12:2525372-2525394 CAGGCCCTGAACACCTATCCTGG + Intronic
1095372417 12:41484946-41484968 CTGGTCCTTACCATGTTTCCTGG + Intronic
1096242359 12:49966210-49966232 GTGGCCCAGCCCCCTTTTCCAGG + Intergenic
1097155204 12:57006966-57006988 CTGACCCTTACCACACTTCCTGG + Intergenic
1097966412 12:65586268-65586290 CTGCCTCTCACCACTTTTCCAGG - Intergenic
1098299291 12:69037733-69037755 CTTGCCCGGCCCACTTTTCAAGG + Intergenic
1101235465 12:102784654-102784676 CTCTCCCTGACCACTTTTCCTGG - Intergenic
1103328423 12:120137130-120137152 CTGGCCCTTACCCCTGTCCCAGG - Intronic
1104408744 12:128540827-128540849 CGGGCCCTGACGATTTCTCCAGG - Intronic
1105931340 13:25055685-25055707 CTGGCACTGAGCTGTTTTCCTGG + Intergenic
1106567761 13:30900969-30900991 CTGTCCTTGTCCACCTTTCCTGG - Intergenic
1106886789 13:34194823-34194845 CTTCCCCTGATGACTTTTCCTGG + Intergenic
1110939303 13:81329435-81329457 CTGGCACTGACGTCTTTTCCGGG + Intergenic
1113681212 13:112246247-112246269 CTGGGCCCACCCACTTTTCCAGG + Intergenic
1113856142 13:113446361-113446383 CTTGTCCTGAGCACTTCTCCGGG - Intronic
1114539848 14:23446737-23446759 CTGGCCCTGTCTACTTCTCAGGG + Intergenic
1117007928 14:51441269-51441291 CGGGCCCTGCCCACAGTTCCAGG + Intergenic
1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG + Intronic
1118313386 14:64708782-64708804 CTGGCCATGACCACTTCCCTAGG - Intronic
1118952214 14:70445359-70445381 TTGCCACTGACCAGTTTTCCAGG + Intergenic
1119712418 14:76831669-76831691 TTGGGCCTGGTCACTTTTCCTGG - Intronic
1119735099 14:76976570-76976592 ATGGCCCTGGCCACGTTTCAGGG - Intergenic
1119741367 14:77015653-77015675 CTGGACCTTTCCGCTTTTCCTGG + Intergenic
1119762181 14:77159379-77159401 CTGACCCTGAACAATATTCCTGG + Intronic
1120751158 14:88199503-88199525 CTTGCCCTGGCTGCTTTTCCAGG - Intronic
1120859494 14:89241958-89241980 CTGGTCCTGACGCCTTGTCCGGG - Intronic
1121319945 14:92986488-92986510 CTGGCTCCGATCACTTTTCTAGG - Intronic
1121320065 14:92987067-92987089 CTGGACCTGACAACCTCTCCAGG + Intronic
1121443129 14:93961561-93961583 CCTGCCCTGACCACTCTCCCGGG - Intronic
1121690572 14:95875319-95875341 CTTGCTCTGACCATGTTTCCCGG + Intergenic
1122188539 14:100021409-100021431 CTGGCCCTGAAAAATTTTACTGG + Intronic
1126679251 15:51187864-51187886 CTGGCCCCTACCACGTGTCCGGG - Intergenic
1129679091 15:77647828-77647850 TTGGCCCTCAGCACTTTTCCTGG + Intronic
1130196710 15:81786172-81786194 CTGGCCCTGCTCTCTTTTCTGGG - Intergenic
1133588600 16:7220268-7220290 CTGGTCCTGCCCATTTTTCCTGG + Intronic
1136062941 16:27739165-27739187 CTGGGTCTGACCTCTTTACCTGG - Intronic
1137394005 16:48104454-48104476 CAGGGCCTGACCTTTTTTCCAGG + Intronic
1138560739 16:57799613-57799635 CCAGCCCTGACCTCTCTTCCAGG - Intronic
1138598514 16:58041892-58041914 CTGGCCCTGAGCCTTTTCCCTGG + Intronic
1140032701 16:71351122-71351144 CTGGCCCTGCCAACCTCTCCAGG + Intergenic
1141325889 16:83059029-83059051 CTGCACCTGACCACTTGTCCTGG - Intronic
1141606756 16:85158409-85158431 CTGGCCCTGCCCAGGTCTCCTGG - Intergenic
1142246766 16:88973784-88973806 CTGGACGTGACCCCTTTGCCAGG + Intronic
1142420482 16:89966678-89966700 TTGGCCCAGCCCACCTTTCCTGG + Exonic
1142425778 16:90001556-90001578 CTGTTCGTGAACACTTTTCCTGG + Intergenic
1142642954 17:1295310-1295332 GAGGCCCTGGCCACTTCTCCGGG + Intronic
1148155734 17:45424497-45424519 CTGGCACTGACCACCCATCCAGG + Intronic
1148563874 17:48621732-48621754 CTGTCCCAGACCACTTGTCCCGG + Exonic
1148585821 17:48778952-48778974 CAGGCCCTCACCACCGTTCCTGG - Intronic
1150387424 17:64773161-64773183 CTGGCACTGACCACCCATCCAGG + Intergenic
1150855015 17:68744269-68744291 CCACCCCTCACCACTTTTCCAGG - Intergenic
1152521296 17:80858344-80858366 CTGGCCCAGACCACCTGTGCAGG - Intronic
1152572585 17:81127189-81127211 CTGGGCCTGGCCACTTCCCCAGG - Intronic
1152601505 17:81264518-81264540 GAGGCCCTGATCACTTCTCCGGG - Intronic
1152865168 17:82718026-82718048 CTGGCCCTGACCTGTTCTGCGGG + Intronic
1155138785 18:23023652-23023674 CTGGACATTACCACTATTCCAGG + Intronic
1155640922 18:28013727-28013749 CTGCCACTTGCCACTTTTCCTGG + Exonic
1157700103 18:49756901-49756923 CAGGCCCTGTCCACTTTACCAGG + Intergenic
1159009782 18:63047701-63047723 CTGGCCTGGACCCCTTTTCAGGG - Intergenic
1160286442 18:77547755-77547777 AAGGCCCTGACCTTTTTTCCAGG - Intergenic
1160532730 18:79575090-79575112 GTGGCCCTGACCCCTCTGCCAGG + Intergenic
1162334719 19:10053187-10053209 CTTCACCTGACCACTTTCCCAGG + Intergenic
1162423319 19:10578692-10578714 CAGGCACTCACCACTTTACCAGG + Intronic
1163440631 19:17320881-17320903 GTGGCCCTGACCACTGAGCCTGG + Exonic
1164679505 19:30124247-30124269 CTGTCCCTGAGAACTTCTCCAGG - Intergenic
1165734875 19:38169833-38169855 CTGACCCTGACCCCTCTGCCTGG - Intronic
1166069164 19:40377404-40377426 CTGGCCCTGACCCCTCTGCCTGG - Intronic
1166120123 19:40681284-40681306 CTGGCCCTGACCCCTCTGCCTGG - Intronic
1166940338 19:46359544-46359566 CTAGCCCTGACCACTGTTTTTGG - Intronic
1167301162 19:48678567-48678589 CTGGCCCTGAGCACCGTGCCTGG + Intergenic
925682931 2:6442083-6442105 CTGTCCCTGAAAACTTTTCAGGG - Intergenic
925894578 2:8461468-8461490 GTGACCCAGACCACATTTCCAGG - Intergenic
926607648 2:14913731-14913753 CTGGCCCTCATCACTCTTCATGG - Intergenic
926886916 2:17606447-17606469 CTGGCCCTCACCACTGCTCTGGG - Intronic
927101644 2:19792102-19792124 CTGGCCGTGACTACTTGTCCAGG + Intergenic
928132385 2:28662013-28662035 GAGTCCCTGACCATTTTTCCTGG + Intergenic
928147021 2:28787912-28787934 TTAACCCTGACCTCTTTTCCAGG + Intronic
929047319 2:37802617-37802639 CTGGCCCAGCCCACCTGTCCAGG + Intergenic
929124209 2:38508659-38508681 CTGGCTCTGAGCCCTTTGCCTGG - Intergenic
931985078 2:67733676-67733698 CTGGCCATGACCACTGGTTCTGG - Intergenic
933174942 2:79164499-79164521 TTATCCCTGACCACTTTTCAAGG + Intergenic
934871364 2:97869403-97869425 CTGGCCCTGCCCTTTCTTCCAGG + Intronic
935913832 2:107927230-107927252 CTGGCCAGCACCACTTTGCCTGG + Intergenic
936010015 2:108919652-108919674 CTGGCCCTGACTGCTTTTCTAGG + Intronic
937306897 2:120877164-120877186 CTGCCCCTGAGCACTGTCCCTGG + Intronic
938698351 2:133854686-133854708 GTGGGCCTGCCCACTTCTCCGGG + Intergenic
939156077 2:138525581-138525603 CTGGCCCTGAGCAATCATCCTGG - Intronic
940739027 2:157485804-157485826 CTGCCCCAAACCATTTTTCCTGG + Intronic
942144059 2:173008318-173008340 CTTGCCCTACCCACTTTACCAGG + Intronic
1168763029 20:362637-362659 CCTGCCCTGACCACGTGTCCCGG - Intergenic
1172784813 20:37460917-37460939 CTGGCCCTGACTAACCTTCCAGG + Intergenic
1173059791 20:39650581-39650603 CTGGCTCTGTCCGCTGTTCCTGG + Intergenic
1174379237 20:50146118-50146140 CTGGCCCTGACCCCTTCACAGGG - Intronic
1175256945 20:57653236-57653258 CTGGCCCTGGGCGCTTTTCCAGG + Intronic
1176269712 20:64229888-64229910 CTTGCCCTGCCCACTGTCCCTGG + Intronic
1178279825 21:31271821-31271843 CTGGCCCTGAGCACTCCCCCAGG - Intronic
1178481975 21:32987315-32987337 CTGACCCTGACCTCTCTGCCAGG - Intergenic
1181015554 22:20066536-20066558 CTTGCCCAGACCACTTTGCTGGG + Intergenic
1181111608 22:20605931-20605953 CTGGCCCAGACAAATTTTCATGG - Intergenic
1181312941 22:21955305-21955327 CTGGCCCTGCCCACCTAGCCAGG - Intergenic
1181346049 22:22221377-22221399 CTGGCCCTGCCCACCTAGCCAGG - Intergenic
1182066247 22:27433747-27433769 GTGGCCCTGACCTCTGTCCCAGG + Intergenic
1182338436 22:29600970-29600992 CTGGCCCTGACCTCCCTTCTGGG + Intergenic
1183381085 22:37490924-37490946 CTGGGCCTCCCCACCTTTCCTGG - Exonic
1183407095 22:37635577-37635599 CAGGCCCTTGCCACTTCTCCTGG - Intronic
1184262175 22:43324706-43324728 CAGGCTCAGACCACTTTTTCAGG + Intronic
1184275290 22:43406347-43406369 CTGGCCCCGACCACTTTCCCTGG + Intergenic
1184430310 22:44438463-44438485 CTGGCACTGCCCATTTCTCCAGG + Intergenic
1185221275 22:49630306-49630328 CAGGCCCCGGCCACTTTCCCGGG - Intronic
1185232037 22:49688937-49688959 CTGGCCCTGCCCTCTCCTCCAGG - Intergenic
949875446 3:8623503-8623525 CTGGCTCTGACGTCTCTTCCTGG - Intronic
950345634 3:12288860-12288882 CAGGCGCTGACCACTCCTCCTGG + Intronic
950963401 3:17128987-17129009 CTGGCCCTGATGTCTTTTGCAGG - Intergenic
951649656 3:24936968-24936990 CTGGCACTGAAGACTTATCCAGG - Intergenic
952388283 3:32859005-32859027 CTGCCCCTCACCACTTTTATAGG + Intronic
954315587 3:49799621-49799643 CTGGCCCTCACCCCTTCTCTTGG - Intronic
954715213 3:52523545-52523567 CAGGCCCTGACAACAGTTCCTGG + Exonic
954864467 3:53717323-53717345 CTGTCCCTCACCCCTATTCCAGG + Intronic
957572328 3:81963055-81963077 CTTACGCTGACCACATTTCCTGG + Intergenic
958485692 3:94704840-94704862 GTGGCCTTTATCACTTTTCCCGG + Intergenic
960114153 3:113876758-113876780 AGGGCCCTAACCAATTTTCCAGG - Intronic
961465227 3:127077256-127077278 CTGGCCCAGACTACTTCTCCAGG - Intergenic
961509004 3:127389955-127389977 CTGGCCCTGCCCATTCCTCCAGG - Intergenic
967943710 3:194786045-194786067 ATGGCCCTGCCCAAATTTCCTGG - Intergenic
968554644 4:1240752-1240774 CTGCCCCTGACCACCGTGCCAGG + Intronic
969503940 4:7571714-7571736 CTGGCCTTGGCCCCTTTTCCTGG - Intronic
973655413 4:53042798-53042820 CTGGAGCTGACCACCTTTCTTGG + Intronic
978268502 4:106858648-106858670 AAGGCCCTGACCACTCTTCATGG - Intergenic
979615874 4:122741750-122741772 ATTGCACTGACCACTTTTCATGG + Intronic
980730858 4:136823324-136823346 CTGGGCATCACCACATTTCCTGG - Intergenic
980750545 4:137081384-137081406 CTGGCCCACACCACTATGCCTGG + Intergenic
983644906 4:169979707-169979729 CTTGTCCAGACCCCTTTTCCCGG - Intergenic
983720923 4:170850585-170850607 CAGCCCCTAACCACTTTTTCTGG - Intergenic
986280155 5:6315950-6315972 CTGGCCCTGACTCCCTTCCCTGG - Intergenic
990181412 5:53164643-53164665 ATGGCCCTGACCACCCCTCCTGG - Intergenic
991599920 5:68341966-68341988 CTGGCCCTTACCCCTTCTCCTGG - Intergenic
995981645 5:118111735-118111757 CTGGCACTGACCTCCTTCCCTGG - Intergenic
996982180 5:129512039-129512061 TGGTCCATGACCACTTTTCCAGG - Intronic
997843951 5:137269047-137269069 CTGGACCTTGCCACTTTTTCAGG + Intronic
999234616 5:150083003-150083025 CGCTCCCTGACCACATTTCCTGG - Intronic
999259478 5:150229139-150229161 CTGGGCCTGACACCTTCTCCTGG - Intronic
1000965649 5:167652972-167652994 CTGACCCTGATTACTTTTCTAGG + Intronic
1001430535 5:171657863-171657885 CTGCACCTGTCCACCTTTCCAGG - Intergenic
1001493032 5:172168973-172168995 CTGCCCCTGCCCACTTCCCCAGG + Intronic
1001627068 5:173144802-173144824 CTGGCCTTGATCCTTTTTCCGGG + Intronic
1002565152 5:180108772-180108794 CTGGCCCTGACCTCAGCTCCAGG - Intronic
1003156744 6:3603359-3603381 CTGTACCTGAGCATTTTTCCAGG - Intergenic
1003197290 6:3926152-3926174 CTGGCACTGCCCACTCTTCATGG - Intergenic
1003318530 6:5032997-5033019 CTGGCACTGCCCACTCTTCATGG + Intergenic
1006576910 6:35053283-35053305 CTGCCCCTGGCCAGGTTTCCTGG + Intronic
1006929847 6:37681007-37681029 CTGGTCCTGCCCAGGTTTCCTGG - Intronic
1006986613 6:38179814-38179836 CCTGCCCTGACCCCTCTTCCAGG - Intronic
1007385645 6:41518492-41518514 CTGGCCCTGGCCCACTTTCCTGG + Intergenic
1007690096 6:43695314-43695336 TTGGCCCTGACCCCTCTTCCTGG - Intergenic
1007695805 6:43733816-43733838 CTGGCCCTGCCCTCTGATCCTGG + Intergenic
1007711823 6:43829115-43829137 CTTGCCCTGCCCACTTCTCCGGG - Intergenic
1007996011 6:46308689-46308711 TTTGGCCTGACCACATTTCCAGG - Intronic
1010166225 6:72918058-72918080 CTGGCCCTCACACCTTTCCCAGG - Intronic
1011215940 6:85005653-85005675 CTAGCTCTGCCCACTTTCCCCGG - Intergenic
1013263565 6:108471315-108471337 CTGGACCTGATCATTTTTCTTGG + Intronic
1013421298 6:109969646-109969668 CTGCCCCTGCCCACTTTCTCAGG + Intergenic
1013634774 6:112018771-112018793 CTGACCCTGCCAACATTTCCTGG - Intergenic
1017750547 6:157487168-157487190 CCGGCCCTGGCCACCTTGCCGGG + Intronic
1018473999 6:164122451-164122473 GTGGCCCTCACCACTGCTCCTGG - Intergenic
1020035073 7:4959458-4959480 CTGGCCCCGGCCCCTTTTCCCGG + Intergenic
1022958319 7:35401632-35401654 CCGGCCCTGACCTCTCTGCCTGG - Intergenic
1026524627 7:71143446-71143468 CTGGCTCTGACCACCTCTCAAGG - Intronic
1028488759 7:91387876-91387898 CTGGGCCTGGACACTTTCCCTGG - Intergenic
1029278828 7:99424043-99424065 CTGGCCCTGGCCGCTGGTCCCGG - Intronic
1029906483 7:104098532-104098554 CTGGTCTGGAACACTTTTCCTGG - Intergenic
1032401342 7:131626388-131626410 CTGGCCCTGACCCTGCTTCCTGG - Intergenic
1039027305 8:33271732-33271754 CTGGAGCTGCTCACTTTTCCAGG - Intergenic
1039791224 8:40877179-40877201 CTGCCCCTGACCACTGTTCTTGG - Intronic
1040469933 8:47728655-47728677 CAGGCCCTGACCTCCCTTCCTGG + Intronic
1040690657 8:49934241-49934263 CTGGCCATGATCACCTCTCCTGG + Intronic
1045855901 8:106765277-106765299 CTGGCACTGAAAACATTTCCTGG + Intronic
1047319960 8:123769435-123769457 CTGGCCCTGACCACTTTTCCAGG - Intronic
1047487275 8:125342815-125342837 TTGGCTCTGACCACTTTGTCAGG + Intronic
1048338832 8:133523402-133523424 CTGGCTCTGCCCACTTTGCTGGG + Intronic
1048604094 8:135949580-135949602 CTGGCCCACACAACTGTTCCTGG + Intergenic
1051871249 9:21740111-21740133 TTTGCCCAGACCACTATTCCTGG - Intergenic
1055321486 9:75087738-75087760 CTGTCCCTGGCGACTTCTCCAGG + Intronic
1057004713 9:91547059-91547081 CTGCCCCTGACTCCTTTTCCTGG - Intergenic
1057170657 9:92961133-92961155 CTGGCCATGGCCAGCTTTCCTGG + Intronic
1061183834 9:129040557-129040579 TTGGCCCTGAGGACTTTGCCTGG + Exonic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1061820926 9:133226825-133226847 CTGGCACTGGCCACTTATCCTGG + Intergenic
1062238343 9:135523228-135523250 CTGGCACCGGCCACTTATCCTGG - Exonic
1188004372 X:25007159-25007181 CTGGGCCTGAGCACTTTCCTCGG - Exonic
1188393608 X:29652781-29652803 CTGGCCCTGATCAGTTATCTTGG + Intronic
1190282082 X:48937585-48937607 CTGCCACTGACCCCTTTGCCTGG + Intronic
1190459564 X:50658746-50658768 CTGGCCCTCAGCACTCTTCTTGG - Intronic
1190570867 X:51779927-51779949 CTGGCCCTGCCTACCTCTCCAGG + Intergenic
1191643658 X:63454880-63454902 CGGGCTCTTACCACTTTTCTCGG - Intergenic
1191650905 X:63536929-63536951 CAGTCCCTCACCACTTTTCTTGG - Intergenic
1194485230 X:94478226-94478248 CTGGCTATGACCAATTTGCCAGG + Intergenic
1197769749 X:130082502-130082524 CTGGCTCAGGCCCCTTTTCCAGG + Intronic
1198369097 X:135973997-135974019 CTGGCCCTGCCCCCATTTGCCGG - Exonic
1198399883 X:136258736-136258758 CTGAATCTGACCAATTTTCCCGG - Intergenic
1198833425 X:140776258-140776280 CTGGCCGAGGCCAATTTTCCAGG - Intergenic
1199978622 X:152908770-152908792 CTGGCCCTGGCCACACTCCCAGG - Intergenic
1200215310 X:154365636-154365658 CTGGCCCAGGCCACAGTTCCTGG - Intronic
1202340503 Y:23859690-23859712 TTGGCCCTGAACATTTTTCTTGG + Intergenic
1202390821 Y:24368830-24368852 CTGGCTCAAACAACTTTTCCAGG - Intergenic
1202479963 Y:25301286-25301308 CTGGCTCAAACAACTTTTCCAGG + Intergenic
1202530263 Y:25810392-25810414 TTGGCCCTGAACATTTTTCTTGG - Intergenic