ID: 1047323516

View in Genome Browser
Species Human (GRCh38)
Location 8:123813111-123813133
Sequence ATGGAACTCTTCCTCTGAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047323513_1047323516 5 Left 1047323513 8:123813083-123813105 CCTATACTTTGGGGGATCAAGGG 0: 5
1: 0
2: 8
3: 123
4: 2323
Right 1047323516 8:123813111-123813133 ATGGAACTCTTCCTCTGAAAAGG 0: 1
1: 1
2: 1
3: 16
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047323516 Original CRISPR ATGGAACTCTTCCTCTGAAA AGG Exonic
900655033 1:3752635-3752657 ATCGAACTGTGCCTCTGAGATGG - Exonic
900977093 1:6024761-6024783 ATGGAACTCTGGCTCTGGACAGG - Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
906271551 1:44483252-44483274 ATGGAACTCATCCTTTTAAAAGG - Intronic
907820757 1:57965846-57965868 ATGGAAGTCTTCCACTTTAATGG - Intronic
908380850 1:63595104-63595126 CTGGAACGCATCCCCTGAAATGG + Intronic
908528403 1:65010133-65010155 ATTAGACTCTTCCTCTTAAAGGG - Intergenic
910289829 1:85589081-85589103 AGGCTCCTCTTCCTCTGAAAAGG + Intergenic
910949425 1:92629990-92630012 ATGGAACTCATCCTTTTTAATGG + Intronic
911793445 1:102047295-102047317 ATAAAACTATCCCTCTGAAATGG + Intergenic
914387588 1:147186501-147186523 ACGTAACTCTTCTTCTGATAGGG - Exonic
918512167 1:185323207-185323229 ATGGAAGATTTTCTCTGAAAGGG - Intergenic
920309848 1:205042764-205042786 TTGGATCTCTTCCTCGGATAGGG + Intergenic
921759157 1:218892134-218892156 ATGGAAGTCTTCTTCTGATTGGG - Intergenic
1063737734 10:8779942-8779964 TTGGAACTCCTTCTCTGAAAAGG + Intergenic
1064665325 10:17644563-17644585 ATGGGACTCATCCTGTGAAATGG + Intronic
1065601880 10:27377388-27377410 AGGGAACTAATGCTCTGAAAGGG - Intergenic
1066479786 10:35784591-35784613 CTGGAAATCTTCCTCTCAAAGGG + Intergenic
1066670065 10:37827676-37827698 AGGTAAGTCTTCCTCAGAAAAGG + Intronic
1067359379 10:45563548-45563570 ATGGTATTTTTCCTCTGAATTGG - Intronic
1070116474 10:73533715-73533737 ATTGATTTCTTCCTCTGACATGG + Intronic
1070434240 10:76372912-76372934 ATGGAACACTGCTTCAGAAAAGG + Intronic
1076176062 10:128368813-128368835 ATGGAATTTTTCCTCTTAAAAGG - Intergenic
1076223943 10:128758413-128758435 ATGGGACTTGTTCTCTGAAAAGG + Intergenic
1078016609 11:7620387-7620409 ATCAATCTCTTCCTCTGAACTGG + Intronic
1078112654 11:8410850-8410872 ATGGAATTCTTGCTTTGTAATGG - Intronic
1081931432 11:46874142-46874164 AGGGAACTCTACCTCAGAATGGG + Intronic
1086737805 11:90328682-90328704 TTGGACTTCTGCCTCTGAAATGG + Intergenic
1088471033 11:110187652-110187674 TTGGACCTCTTCCTCTGCACTGG + Intronic
1091170767 11:133517991-133518013 ATGGGACTCCTCCTCGGAACTGG - Intronic
1094064971 12:26352350-26352372 ATGGCACTCTTCCTCTAACCAGG + Intronic
1097893907 12:64805383-64805405 ATTTAGCTCTTCCTCTAAAAGGG - Intronic
1098214748 12:68203784-68203806 AAGAGACTCTTCCTGTGAAAGGG + Intronic
1098531499 12:71546770-71546792 ATGAAAGTGTTTCTCTGAAATGG - Intronic
1098532762 12:71559235-71559257 ATGGAGCTCTTCAACTGAACCGG - Intronic
1099640030 12:85274505-85274527 AAGGAAGTCTTTCCCTGAAATGG + Intergenic
1100616695 12:96236509-96236531 CTGGAACTCTGTCTCTGAACAGG - Intronic
1103211213 12:119167892-119167914 AAGGATCTCTTCCTCTCAGAAGG + Intergenic
1103374415 12:120444428-120444450 AGGGAACTAATGCTCTGAAAAGG - Exonic
1104206685 12:126645423-126645445 ATGGAACTGTGCACCTGAAATGG - Intergenic
1105448267 13:20475764-20475786 GTGGGAATCTTCCGCTGAAAGGG - Intronic
1106982182 13:35300490-35300512 ATGAAACATTGCCTCTGAAATGG - Intronic
1107144239 13:37040854-37040876 ATGAAATACTTCCTCTGAAAAGG - Intronic
1110520686 13:76472522-76472544 AAGGGACTCTACCTCAGAAAAGG + Intergenic
1112460825 13:99602375-99602397 ATGGAAGCCTTCATATGAAAAGG - Intergenic
1113054132 13:106249422-106249444 ATGAATTTCTTCCTCTGCAATGG + Intergenic
1113717981 13:112527776-112527798 ACGGAGCTCTTCCTCAGTAACGG + Intronic
1115788210 14:36850107-36850129 ATACATCTCTTCCTCTGGAAGGG - Intronic
1116639334 14:47440878-47440900 ATTTAATTCTACCTCTGAAAAGG - Intronic
1117185507 14:53236129-53236151 TTGGAAATCTTCCTCTCAATAGG + Intergenic
1118466234 14:66033825-66033847 ATGGAACTAGTCCTCTTGAAAGG + Intergenic
1120421779 14:84295944-84295966 ATGGAAAGATTTCTCTGAAAAGG - Intergenic
1123456680 15:20432625-20432647 CTGGAAATCTTTCTCTTAAAGGG + Intergenic
1123661382 15:22567735-22567757 CTGGAAATCTTTCTCTTAAAGGG - Intergenic
1124262827 15:28207767-28207789 CTGGAAATCTTTCTCTTAAAGGG + Intronic
1124315182 15:28661967-28661989 CTGGAAATCTTTCTCTTAAAGGG - Intergenic
1125020438 15:34980267-34980289 TTGAAATTATTCCTCTGAAAAGG + Exonic
1125241312 15:37580489-37580511 TTGAAATTCTTCATCTGAAAAGG + Intergenic
1125920671 15:43523719-43523741 ATGGATCTCCTCATCTGAGATGG - Exonic
1125927093 15:43571814-43571836 ATGGAACCGTTCCTCTGATAAGG + Exonic
1125940237 15:43671379-43671401 ATGGAACCGTTCCTCTGATAAGG + Intergenic
1126540482 15:49817031-49817053 ATAGAATTCTTTATCTGAAAGGG + Intergenic
1127464207 15:59227918-59227940 AGAGTGCTCTTCCTCTGAAAGGG - Intronic
1127567672 15:60208733-60208755 ATGCAACCATTCCCCTGAAATGG - Intergenic
1127602085 15:60547784-60547806 ATATAACTCTTCTTCTGAAATGG - Intronic
1128273104 15:66329095-66329117 ATGGAACTCCTCCTCCGCACAGG - Exonic
1129200802 15:73998011-73998033 CTGGAACTCCTCCTCCGAAGCGG - Exonic
1131489684 15:92851883-92851905 ATGAAACTCTTCCTTTGAGTTGG - Intergenic
1133294965 16:4747224-4747246 ATTGCATTCTTGCTCTGAAATGG + Intronic
1133417704 16:5619291-5619313 ATGGAACTCTGACCCTGGAACGG + Intergenic
1134827167 16:17294122-17294144 AAGCAACTGTTCCTCTGAAGGGG + Intronic
1137776254 16:51056701-51056723 ACAGGATTCTTCCTCTGAAATGG - Intergenic
1138724628 16:59122500-59122522 ATGGTACTCTATCTCTGACATGG - Intergenic
1140198411 16:72875002-72875024 AGGTCTCTCTTCCTCTGAAAGGG + Intronic
1140439067 16:74972907-74972929 TTGGATCTTGTCCTCTGAAATGG - Intronic
1141292490 16:82732865-82732887 ATCAGACTCTTCCTCTGTAATGG - Intronic
1144290424 17:13821084-13821106 ATGAAACTTTTACTCTGGAAAGG - Intergenic
1149596267 17:57866531-57866553 CCGGAAGTCTTCATCTGAAAAGG + Exonic
1150674707 17:67234904-67234926 AGGGAACACTTCCACTGAAGAGG - Intronic
1152279256 17:79375734-79375756 ATGAAACCCCTCCTTTGAAAGGG + Intronic
1152615011 17:81333936-81333958 AGGGAACCCTTCCTCTGGCAGGG + Intergenic
1152797755 17:82316396-82316418 TTGGGACTGTTCCTCTGAGAAGG + Exonic
1153089810 18:1330879-1330901 ATTAAACTCTTCCTCTGATCAGG - Intergenic
1153612955 18:6906310-6906332 ATTGAACTGTCCCTTTGAAATGG - Intronic
1154149768 18:11897200-11897222 AATGAACTCTTCCTCTTTAATGG + Exonic
1154220807 18:12452202-12452224 GTAGAACTCTTCTTCTGCAAAGG + Intronic
1155210835 18:23600150-23600172 ATTGAATTATTCCTTTGAAAGGG - Exonic
1155280450 18:24234260-24234282 AGGGAACACTTCCTGGGAAAAGG - Intronic
1157113328 18:44841492-44841514 TTGGTACTCTTCCTCTCAAAAGG - Intronic
1157981397 18:52385559-52385581 GTGGAACTGTTCCCCTGGAATGG - Intronic
1158250072 18:55477996-55478018 CTGTAACTCTTCCTCAGGAATGG + Intronic
1160628608 18:80230020-80230042 AGGGTCTTCTTCCTCTGAAATGG - Intronic
1161901990 19:7125924-7125946 TTGGAGCTCTTCCCATGAAAAGG + Intronic
1165023910 19:32945559-32945581 ATGGAAGGCTTCCTCTGTAGAGG + Intronic
1168260176 19:55188996-55189018 ATGAGACTCTTTCTCGGAAAAGG - Intronic
925998842 2:9313929-9313951 ACATAATTCTTCCTCTGAAAGGG + Intronic
927760822 2:25752079-25752101 ATGGAACTCTTAATCTCAATAGG + Intronic
928165075 2:28965212-28965234 ATTGAACTCTTCCTGTTAATTGG + Intronic
929750900 2:44712508-44712530 ATGGAGCCCTACCTCTGAACGGG + Intronic
930409734 2:51010111-51010133 ATGGGTCTCATCTTCTGAAATGG + Intronic
931603433 2:64027360-64027382 ATTGAACTCTTACTTTGAACAGG - Intergenic
939285924 2:140129217-140129239 ATGTAAGTCTTCCTTTGAGAAGG + Intergenic
939387907 2:141525223-141525245 ATGGAAGTCTTCCTAATAAAGGG + Intronic
940909596 2:159198497-159198519 ATGGGACTCTTCCTGTCAAAGGG - Intronic
941815984 2:169796654-169796676 ATGGAACTCTGCTTCTGGAAGGG + Intronic
943400945 2:187410267-187410289 TTGAAACTCTTCCACTCAAATGG - Intronic
943445829 2:187986793-187986815 ATCCAATTCTTCCTCTGTAAAGG - Intergenic
947088419 2:226481814-226481836 ATGGAAGAGTTCCTCTCAAATGG + Intergenic
948165838 2:235861923-235861945 ATGGTTCTCTTCCTCCCAAATGG - Intronic
1170761974 20:19258949-19258971 ATGGAAATCTTCTAGTGAAATGG - Intronic
1171165149 20:22963614-22963636 AAGGAACTCTTCATTTGTAAAGG + Intergenic
1173185318 20:40836011-40836033 AAGGAATGCTTCCTCTGACAGGG - Intergenic
1175334391 20:58185583-58185605 ATGGAATCCTGCCTCTGAGATGG + Intergenic
1176998265 21:15580985-15581007 ATTAAACTCTTCCTCTGCTAAGG - Intergenic
1179385774 21:40940739-40940761 ATAAAACTCTTCAACTGAAAAGG + Intergenic
1179386521 21:40948041-40948063 CAGGCTCTCTTCCTCTGAAAAGG + Intergenic
1180916928 22:19495414-19495436 ATGGGACAATTTCTCTGAAATGG + Intronic
1181301799 22:21885609-21885631 AATGAACTCTTCCTCTTTAATGG + Intergenic
1182396431 22:30039729-30039751 AGGGAGCTCTTCCTGAGAAACGG - Intergenic
1182533573 22:30982233-30982255 AGGGAGATCTTCCTCTTAAAGGG - Intergenic
1185092545 22:48784153-48784175 CTGGAACTCTGCATCTGCAAGGG + Intronic
950943712 3:16922665-16922687 ATGAAACTCTACCTGTGAATGGG + Intronic
952175299 3:30855906-30855928 ATGGAAAACTTCCTCTGATCTGG + Intronic
956731049 3:72196988-72197010 ATTAATCTCTTCCTATGAAAAGG - Intergenic
957625461 3:82648339-82648361 ATGGATCTCTTGCTCTACAAAGG - Intergenic
959909212 3:111744602-111744624 ATGGATCTCATCATTTGAAATGG - Intronic
967971987 3:195006002-195006024 ATGGTAGGCTTCCTCTGAGATGG - Intergenic
968119900 3:196118763-196118785 CAGGAACTCTTACTCTGAATAGG + Intergenic
969295415 4:6267821-6267843 CTGAATATCTTCCTCTGAAAGGG + Intergenic
969896472 4:10309816-10309838 ATGAAAATCTTCCTCTGAATAGG + Intergenic
973257623 4:48128980-48129002 ATGGATTTCTACCTCTGAACAGG + Intronic
977070046 4:92374061-92374083 ATGGACCTCCTCCTCAGCAAGGG + Intronic
978092613 4:104736619-104736641 TTGGAAGGCTTCCTCTGCAATGG + Intergenic
979903716 4:126256656-126256678 ATAGAACCCTTCTTCTCAAAGGG + Intergenic
982432993 4:155344496-155344518 ATAGAACTATGCCTCTGAAAGGG - Exonic
983357985 4:166689103-166689125 AAGCAACTCTTCCTCTGAGGAGG + Intergenic
985318815 4:188686398-188686420 TTGGAACTCTTTCTTTTAAATGG - Intergenic
985364676 4:189216080-189216102 TTTTAAGTCTTCCTCTGAAAAGG + Intergenic
987382424 5:17297954-17297976 ATGGAAGTCTCAATCTGAAATGG + Intergenic
989121985 5:38014121-38014143 ATGGAAGTCTTCCTGGTAAATGG + Intergenic
989544308 5:42654949-42654971 TTGAAACTCCTCATCTGAAAGGG + Intronic
993868510 5:93222695-93222717 CTGGGACCCTTCCTCTGGAATGG + Intergenic
993997248 5:94737585-94737607 ATGGAACTATTCCTCAGTAATGG - Intronic
994476601 5:100278903-100278925 ATGGAACTCTGCCACAGAGAGGG + Intergenic
995313245 5:110738182-110738204 ATGGAAGTCTTCCTCAGATCTGG + Intronic
995766465 5:115625144-115625166 ATGGAGCTCTTCCAATGACAAGG + Intronic
998048803 5:139013364-139013386 ATGAAAATCTTCCACTAAAAAGG - Intronic
998424364 5:142013945-142013967 ATGGATCTCTTTTTCTGATATGG - Intergenic
1001379113 5:171291215-171291237 ATACAACTCTGCCTCAGAAATGG + Intronic
1002442510 5:179271740-179271762 ATGGAACAATTCCTTTGCAAAGG + Intronic
1003558237 6:7159458-7159480 ACAGAACTCATCCTCTGGAAAGG - Intronic
1003785451 6:9480734-9480756 ATGGTTGTCTTCCTCCGAAATGG - Intergenic
1006040834 6:31253352-31253374 ATGGAACTCTTCCTCTGAGAAGG - Intergenic
1006051178 6:31345768-31345790 ATGGAACTCTTCCTCTGAGGAGG - Intronic
1006150487 6:31984301-31984323 CTGGAACTCTGCCTTTGAGAGGG - Exonic
1006156788 6:32017039-32017061 CTGGAACTCTGCCTTTGAGAGGG - Exonic
1007188513 6:39993917-39993939 ATGAAAACCATCCTCTGAAAAGG + Intergenic
1007967748 6:46017633-46017655 ATGTAACTATTATTCTGAAAGGG - Intronic
1008110456 6:47487126-47487148 AATGAATTCTTCCTCTTAAATGG - Intronic
1010655353 6:78505148-78505170 AAGGTCCTCTTCCTGTGAAAAGG + Intergenic
1013216252 6:108029974-108029996 ATGGGACTCTTGCCCAGAAAAGG + Intergenic
1013494261 6:110682526-110682548 GTGGCACTCATACTCTGAAAAGG + Intronic
1014281746 6:119449263-119449285 CTGTAACTCTTCCTCTCAGAGGG - Intergenic
1016513454 6:144868786-144868808 ATGTAAATCTTCCTTTCAAAGGG + Intergenic
1017108654 6:150912000-150912022 ATGCACCTCCTCCTCTGATATGG - Intronic
1020352568 7:7237262-7237284 ATTGAGCTCTTCCTCTGTACCGG + Intronic
1020844224 7:13262174-13262196 TTGGGACTCTTCTCCTGAAAAGG - Intergenic
1021083590 7:16392519-16392541 ATGCAATCCTTGCTCTGAAAGGG + Intronic
1023255043 7:38304891-38304913 ATTTCACTCTTCCTCTGAACCGG + Intergenic
1032137612 7:129295147-129295169 CTTGACCTCTTTCTCTGAAAGGG + Intronic
1034212509 7:149376429-149376451 AAGGAGCTCTTCCTCACAAAAGG - Intergenic
1036245360 8:7111522-7111544 GTGGAAGTCTTGCCCTGAAATGG + Intergenic
1038006309 8:23433263-23433285 CTGCAACCCTACCTCTGAAATGG + Intronic
1039520524 8:38167171-38167193 AGGGAACTTTTCCTCACAAAAGG + Intronic
1044593849 8:93940023-93940045 ATGGACTTCTTCCTCTGTTAGGG - Intergenic
1045381536 8:101632252-101632274 ATGTCACTCTTCTTCTGTAAAGG - Exonic
1047323516 8:123813111-123813133 ATGGAACTCTTCCTCTGAAAAGG + Exonic
1048862314 8:138733011-138733033 TTGGGAGTCTTCCTCTGAGATGG + Intronic
1052521678 9:29555840-29555862 ATGGAACTTTGAATCTGAAATGG - Intergenic
1053019495 9:34685037-34685059 ATGGAAGTGTCCCTCAGAAATGG + Intergenic
1053064032 9:35054312-35054334 CTGGAACTCATGCTGTGAAATGG - Intergenic
1053137758 9:35662411-35662433 ATGGCTCTGTTCCTATGAAAAGG + Intronic
1053799594 9:41755857-41755879 ATGGACCTCCTCCTCTGCCAGGG + Intergenic
1054145625 9:61559141-61559163 ATGGACCTCCTCCTCTGCCAGGG - Intergenic
1054188003 9:61967917-61967939 ATGGACCTCCTCCTCTGCCAGGG + Intergenic
1054650512 9:67620664-67620686 ATGGACCTCCTCCTCTGCCAGGG - Intergenic
1055144746 9:72919846-72919868 AACAAAGTCTTCCTCTGAAAAGG - Intronic
1055429553 9:76229874-76229896 ATGGTTCACTTCCTATGAAAAGG + Intronic
1056293602 9:85169286-85169308 ATGTAACTCTGTCTCTGACATGG + Intergenic
1059044525 9:110851411-110851433 CTGAAACCCTTCCTCTTAAATGG + Intergenic
1059518317 9:114916210-114916232 GAGGCACTCTTCCTCTGAGACGG - Intronic
1061474063 9:130851385-130851407 CAGGAACTGTTTCTCTGAAAGGG - Intronic
1061819570 9:133218840-133218862 CTGGAGCTCTTCCTCTGCAGAGG - Intergenic
1062238629 9:135524441-135524463 ATGGGCCTCGTCCTCTGACAGGG - Intronic
1187820622 X:23284123-23284145 GTGGAACTGTGCTTCTGAAAGGG - Intergenic
1188633810 X:32402689-32402711 ATGGAACTCTTCACATGAAAAGG - Intronic
1189097450 X:38155482-38155504 ATGGCAATCTTTCTCTGTAAAGG + Intronic
1190616731 X:52241633-52241655 ATGATATTCTACCTCTGAAATGG + Intergenic
1196337743 X:114558391-114558413 ATTGATTTTTTCCTCTGAAAGGG - Intergenic
1196754329 X:119144589-119144611 TTGGAGCTCTGCCTCTGAAGTGG + Intronic
1198476931 X:137003854-137003876 ATTGAACACTGCCTCTCAAAGGG - Intergenic
1198476972 X:137004388-137004410 ATTGAACACTGCCTCTCAAAGGG + Intergenic
1199117468 X:144009109-144009131 ATGGAACACTTATACTGAAAAGG - Intergenic
1199283796 X:146034063-146034085 ATCTAACTCATCCCCTGAAATGG - Intergenic
1199686085 X:150266883-150266905 ATGGAGCTCTTTCTTTAAAATGG + Intergenic
1201488002 Y:14512154-14512176 ATAACACTCTTCCCCTGAAAAGG - Intergenic