ID: 1047323901

View in Genome Browser
Species Human (GRCh38)
Location 8:123818170-123818192
Sequence ATGTGTCCTCACGGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047323893_1047323901 3 Left 1047323893 8:123818144-123818166 CCAGTTCATAGGTGGCCATCTCC No data
Right 1047323901 8:123818170-123818192 ATGTGTCCTCACGGGGTGGAGGG No data
1047323890_1047323901 11 Left 1047323890 8:123818136-123818158 CCTGTTTCCCAGTTCATAGGTGG No data
Right 1047323901 8:123818170-123818192 ATGTGTCCTCACGGGGTGGAGGG No data
1047323892_1047323901 4 Left 1047323892 8:123818143-123818165 CCCAGTTCATAGGTGGCCATCTC No data
Right 1047323901 8:123818170-123818192 ATGTGTCCTCACGGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047323901 Original CRISPR ATGTGTCCTCACGGGGTGGA GGG Intergenic
No off target data available for this crispr