ID: 1047324021

View in Genome Browser
Species Human (GRCh38)
Location 8:123819299-123819321
Sequence CAGGGAGAGCCGTGGGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047324015_1047324021 9 Left 1047324015 8:123819267-123819289 CCTGGGAAGGAAGAGGGAAGGAG No data
Right 1047324021 8:123819299-123819321 CAGGGAGAGCCGTGGGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047324021 Original CRISPR CAGGGAGAGCCGTGGGACCA GGG Intergenic
No off target data available for this crispr