ID: 1047325286

View in Genome Browser
Species Human (GRCh38)
Location 8:123830020-123830042
Sequence TTGAACCTGCACAATCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047325286_1047325291 -1 Left 1047325286 8:123830020-123830042 CCCTCCAGATTGTGCAGGTTCAA No data
Right 1047325291 8:123830042-123830064 AGGCAGGAGCTCTACCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047325286 Original CRISPR TTGAACCTGCACAATCTGGA GGG (reversed) Intergenic
No off target data available for this crispr