ID: 1047325695

View in Genome Browser
Species Human (GRCh38)
Location 8:123833994-123834016
Sequence CATTTTGGGAGGCTAAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047325695_1047325705 20 Left 1047325695 8:123833994-123834016 CCCATTCTTAGCCTCCCAAAATG No data
Right 1047325705 8:123834037-123834059 TACCATGTCCAGCCACTGGTGGG No data
1047325695_1047325700 -10 Left 1047325695 8:123833994-123834016 CCCATTCTTAGCCTCCCAAAATG No data
Right 1047325700 8:123834007-123834029 TCCCAAAATGCTGGGATTACAGG 0: 13221
1: 306476
2: 262600
3: 198956
4: 220194
1047325695_1047325703 16 Left 1047325695 8:123833994-123834016 CCCATTCTTAGCCTCCCAAAATG No data
Right 1047325703 8:123834033-123834055 GAGCTACCATGTCCAGCCACTGG No data
1047325695_1047325704 19 Left 1047325695 8:123833994-123834016 CCCATTCTTAGCCTCCCAAAATG No data
Right 1047325704 8:123834036-123834058 CTACCATGTCCAGCCACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047325695 Original CRISPR CATTTTGGGAGGCTAAGAAT GGG (reversed) Intergenic
No off target data available for this crispr