ID: 1047325696

View in Genome Browser
Species Human (GRCh38)
Location 8:123833995-123834017
Sequence GCATTTTGGGAGGCTAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047325696_1047325703 15 Left 1047325696 8:123833995-123834017 CCATTCTTAGCCTCCCAAAATGC No data
Right 1047325703 8:123834033-123834055 GAGCTACCATGTCCAGCCACTGG No data
1047325696_1047325705 19 Left 1047325696 8:123833995-123834017 CCATTCTTAGCCTCCCAAAATGC No data
Right 1047325705 8:123834037-123834059 TACCATGTCCAGCCACTGGTGGG No data
1047325696_1047325704 18 Left 1047325696 8:123833995-123834017 CCATTCTTAGCCTCCCAAAATGC No data
Right 1047325704 8:123834036-123834058 CTACCATGTCCAGCCACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047325696 Original CRISPR GCATTTTGGGAGGCTAAGAA TGG (reversed) Intergenic
No off target data available for this crispr