ID: 1047325699

View in Genome Browser
Species Human (GRCh38)
Location 8:123834005-123834027
Sequence TGTAATCCCAGCATTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1014016
Summary {0: 13476, 1: 310447, 2: 266634, 3: 201224, 4: 222235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047325699_1047325704 8 Left 1047325699 8:123834005-123834027 CCTCCCAAAATGCTGGGATTACA 0: 13476
1: 310447
2: 266634
3: 201224
4: 222235
Right 1047325704 8:123834036-123834058 CTACCATGTCCAGCCACTGGTGG No data
1047325699_1047325705 9 Left 1047325699 8:123834005-123834027 CCTCCCAAAATGCTGGGATTACA 0: 13476
1: 310447
2: 266634
3: 201224
4: 222235
Right 1047325705 8:123834037-123834059 TACCATGTCCAGCCACTGGTGGG No data
1047325699_1047325709 21 Left 1047325699 8:123834005-123834027 CCTCCCAAAATGCTGGGATTACA 0: 13476
1: 310447
2: 266634
3: 201224
4: 222235
Right 1047325709 8:123834049-123834071 CCACTGGTGGGAATTTAAAGTGG No data
1047325699_1047325703 5 Left 1047325699 8:123834005-123834027 CCTCCCAAAATGCTGGGATTACA 0: 13476
1: 310447
2: 266634
3: 201224
4: 222235
Right 1047325703 8:123834033-123834055 GAGCTACCATGTCCAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047325699 Original CRISPR TGTAATCCCAGCATTTTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr