ID: 1047325700

View in Genome Browser
Species Human (GRCh38)
Location 8:123834007-123834029
Sequence TCCCAAAATGCTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1001447
Summary {0: 13221, 1: 306476, 2: 262600, 3: 198956, 4: 220194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047325695_1047325700 -10 Left 1047325695 8:123833994-123834016 CCCATTCTTAGCCTCCCAAAATG No data
Right 1047325700 8:123834007-123834029 TCCCAAAATGCTGGGATTACAGG 0: 13221
1: 306476
2: 262600
3: 198956
4: 220194
1047325694_1047325700 4 Left 1047325694 8:123833980-123834002 CCTCATGTGATCTGCCCATTCTT No data
Right 1047325700 8:123834007-123834029 TCCCAAAATGCTGGGATTACAGG 0: 13221
1: 306476
2: 262600
3: 198956
4: 220194
1047325693_1047325700 9 Left 1047325693 8:123833975-123833997 CCTAGCCTCATGTGATCTGCCCA No data
Right 1047325700 8:123834007-123834029 TCCCAAAATGCTGGGATTACAGG 0: 13221
1: 306476
2: 262600
3: 198956
4: 220194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047325700 Original CRISPR TCCCAAAATGCTGGGATTAC AGG Intergenic
Too many off-targets to display for this crispr