ID: 1047325701

View in Genome Browser
Species Human (GRCh38)
Location 8:123834008-123834030
Sequence GCCTGTAATCCCAGCATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047325701_1047325703 2 Left 1047325701 8:123834008-123834030 CCCAAAATGCTGGGATTACAGGC No data
Right 1047325703 8:123834033-123834055 GAGCTACCATGTCCAGCCACTGG No data
1047325701_1047325704 5 Left 1047325701 8:123834008-123834030 CCCAAAATGCTGGGATTACAGGC No data
Right 1047325704 8:123834036-123834058 CTACCATGTCCAGCCACTGGTGG No data
1047325701_1047325709 18 Left 1047325701 8:123834008-123834030 CCCAAAATGCTGGGATTACAGGC No data
Right 1047325709 8:123834049-123834071 CCACTGGTGGGAATTTAAAGTGG No data
1047325701_1047325705 6 Left 1047325701 8:123834008-123834030 CCCAAAATGCTGGGATTACAGGC No data
Right 1047325705 8:123834037-123834059 TACCATGTCCAGCCACTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047325701 Original CRISPR GCCTGTAATCCCAGCATTTT GGG (reversed) Intergenic