ID: 1047325702

View in Genome Browser
Species Human (GRCh38)
Location 8:123834009-123834031
Sequence TGCCTGTAATCCCAGCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 905898
Summary {0: 4987, 1: 103398, 2: 243056, 3: 299803, 4: 254654}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047325702_1047325709 17 Left 1047325702 8:123834009-123834031 CCAAAATGCTGGGATTACAGGCA 0: 4987
1: 103398
2: 243056
3: 299803
4: 254654
Right 1047325709 8:123834049-123834071 CCACTGGTGGGAATTTAAAGTGG No data
1047325702_1047325704 4 Left 1047325702 8:123834009-123834031 CCAAAATGCTGGGATTACAGGCA 0: 4987
1: 103398
2: 243056
3: 299803
4: 254654
Right 1047325704 8:123834036-123834058 CTACCATGTCCAGCCACTGGTGG No data
1047325702_1047325705 5 Left 1047325702 8:123834009-123834031 CCAAAATGCTGGGATTACAGGCA 0: 4987
1: 103398
2: 243056
3: 299803
4: 254654
Right 1047325705 8:123834037-123834059 TACCATGTCCAGCCACTGGTGGG No data
1047325702_1047325703 1 Left 1047325702 8:123834009-123834031 CCAAAATGCTGGGATTACAGGCA 0: 4987
1: 103398
2: 243056
3: 299803
4: 254654
Right 1047325703 8:123834033-123834055 GAGCTACCATGTCCAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047325702 Original CRISPR TGCCTGTAATCCCAGCATTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr