ID: 1047325704

View in Genome Browser
Species Human (GRCh38)
Location 8:123834036-123834058
Sequence CTACCATGTCCAGCCACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047325696_1047325704 18 Left 1047325696 8:123833995-123834017 CCATTCTTAGCCTCCCAAAATGC No data
Right 1047325704 8:123834036-123834058 CTACCATGTCCAGCCACTGGTGG No data
1047325695_1047325704 19 Left 1047325695 8:123833994-123834016 CCCATTCTTAGCCTCCCAAAATG No data
Right 1047325704 8:123834036-123834058 CTACCATGTCCAGCCACTGGTGG No data
1047325702_1047325704 4 Left 1047325702 8:123834009-123834031 CCAAAATGCTGGGATTACAGGCA 0: 4987
1: 103398
2: 243056
3: 299803
4: 254654
Right 1047325704 8:123834036-123834058 CTACCATGTCCAGCCACTGGTGG No data
1047325701_1047325704 5 Left 1047325701 8:123834008-123834030 CCCAAAATGCTGGGATTACAGGC 0: 9429
1: 235524
2: 277870
3: 222838
4: 263838
Right 1047325704 8:123834036-123834058 CTACCATGTCCAGCCACTGGTGG No data
1047325699_1047325704 8 Left 1047325699 8:123834005-123834027 CCTCCCAAAATGCTGGGATTACA 0: 13476
1: 310447
2: 266634
3: 201224
4: 222235
Right 1047325704 8:123834036-123834058 CTACCATGTCCAGCCACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047325704 Original CRISPR CTACCATGTCCAGCCACTGG TGG Intergenic
No off target data available for this crispr