ID: 1047326789

View in Genome Browser
Species Human (GRCh38)
Location 8:123846899-123846921
Sequence CTGTATTTTTAGAGAAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047326789_1047326796 25 Left 1047326789 8:123846899-123846921 CCCCGTCTTCTCTAAAAATACAG No data
Right 1047326796 8:123846947-123846969 TGTAATCCCAGCTATTTTGGAGG 0: 26
1: 3385
2: 76148
3: 553173
4: 542974
1047326789_1047326792 -2 Left 1047326789 8:123846899-123846921 CCCCGTCTTCTCTAAAAATACAG No data
Right 1047326792 8:123846920-123846942 AGAAATTAGCCAGATGTGATAGG No data
1047326789_1047326794 22 Left 1047326789 8:123846899-123846921 CCCCGTCTTCTCTAAAAATACAG No data
Right 1047326794 8:123846944-123846966 ACCTGTAATCCCAGCTATTTTGG 0: 725
1: 21619
2: 193694
3: 562819
4: 489575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047326789 Original CRISPR CTGTATTTTTAGAGAAGACG GGG (reversed) Intergenic
No off target data available for this crispr