ID: 1047327429

View in Genome Browser
Species Human (GRCh38)
Location 8:123853325-123853347
Sequence CTGTATTTTTAGAGAAGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047327422_1047327429 25 Left 1047327422 8:123853277-123853299 CCAGAATAGCTGGGATTACAGGT 0: 1266
1: 36417
2: 162720
3: 349600
4: 529574
Right 1047327429 8:123853325-123853347 CTGTATTTTTAGAGAAGACGGGG No data
1047327424_1047327429 -3 Left 1047327424 8:123853305-123853327 CCATCACACCCGGCTAATTTCTG 0: 2
1: 566
2: 11215
3: 67973
4: 156252
Right 1047327429 8:123853325-123853347 CTGTATTTTTAGAGAAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047327429 Original CRISPR CTGTATTTTTAGAGAAGACG GGG Intronic
No off target data available for this crispr