ID: 1047328991

View in Genome Browser
Species Human (GRCh38)
Location 8:123867870-123867892
Sequence CTGCATCTTGATCTGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 1, 2: 12, 3: 97, 4: 418}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047328991_1047328993 -1 Left 1047328991 8:123867870-123867892 CCAGCATCCAGATCAAGATGCAG 0: 1
1: 1
2: 12
3: 97
4: 418
Right 1047328993 8:123867892-123867914 GAACATCAGCATCACCTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047328991 Original CRISPR CTGCATCTTGATCTGGATGC TGG (reversed) Intronic
901087167 1:6618010-6618032 CTGCAACTTGATGTAGATGAAGG + Intronic
902263113 1:15241793-15241815 TTGCTTCTTGATCTGGATTCTGG + Intergenic
902398707 1:16145822-16145844 CTGCATCAGGATCTGAATCCAGG - Intronic
902794181 1:18790127-18790149 CTATTTCTTGACCTGGATGCTGG + Intergenic
903249379 1:22041488-22041510 CTGTATTTTGATCTGGAAGGTGG - Intergenic
904027221 1:27512105-27512127 CTGCATCTTGATCTGGGGACTGG - Intergenic
904683647 1:32245872-32245894 CTGTTGCTTGATCTGGGTGCTGG + Intergenic
905412246 1:37778688-37778710 CTCCATCTTGGTCTGGATCCAGG - Intergenic
906151714 1:43591524-43591546 CTGCGTCTTGACCTGGATGGTGG - Exonic
906235974 1:44210235-44210257 CTACATCTTGATCTGGGTGATGG - Intergenic
906804431 1:48766665-48766687 ATGCCTCTTGACCTGGATCCTGG + Intronic
907378826 1:54067824-54067846 CTGTTTTTTGATCTGGATGCTGG - Intronic
907584211 1:55601892-55601914 CTGTTTCTTGATCTGGGTGTTGG - Intergenic
907883958 1:58576539-58576561 CCGCAGCTCGATCTGGATGGTGG + Exonic
908188415 1:61675335-61675357 CTTTATCTTGAACTGGATGGTGG + Intergenic
908481555 1:64545305-64545327 CTGTTTCTTGATGTGGTTGCTGG - Intronic
909040798 1:70648868-70648890 ATGCTTCTGGATCTGGATCCTGG - Intergenic
909169015 1:72270251-72270273 CTGAATCATGATCTTGATGATGG + Intronic
910376595 1:86578702-86578724 CTTCATCTTGAGCTGAAAGCTGG - Intronic
910784528 1:90980863-90980885 CTATATCTTGATCTAGATGGTGG + Intronic
911563927 1:99440096-99440118 CTACATCTTGATCTGGGTGGTGG + Intergenic
913696027 1:121326697-121326719 CTGTTTCTTGATCTGGGTGCTGG - Intronic
914141537 1:144953362-144953384 CTGTTTCTTGATCTGGGTGCTGG + Intronic
914766128 1:150639418-150639440 CTGTTTCTTGATTTGGGTGCTGG + Intergenic
916295866 1:163219198-163219220 CTGTTTCTTAATCTGGGTGCTGG - Intronic
916322613 1:163521844-163521866 CTGCATCTTGTGCTGTTTGCTGG + Intergenic
916560315 1:165929327-165929349 GTCCATCTTGATCTGAATGATGG + Intergenic
916640984 1:166728881-166728903 CTGCTTCTTGATCTGGGTTTTGG + Intergenic
916810006 1:168296956-168296978 CTGGATATTGTTCTAGATGCTGG + Intronic
917174161 1:172213390-172213412 CTGTTTCTTGATCTGGATGTGGG + Intronic
917620059 1:176786430-176786452 CTGTATCTTGATCTGACTGGTGG + Intronic
917999156 1:180475064-180475086 CTATTTCTTGATCTGGATGCTGG - Intronic
918960589 1:191271559-191271581 CTGTATCTTAATTTGGTTGCTGG + Intergenic
919745375 1:201005377-201005399 CTGCACGTTCATCTGGGTGCTGG + Exonic
920113082 1:203600752-203600774 CCACATCTTCATCTGGGTGCAGG - Intergenic
920384646 1:205562103-205562125 CTATATCTTGATGTGGATGGTGG + Intergenic
920483354 1:206345065-206345087 CTGTTTCTTGATCTGGGTGCTGG - Intronic
921971702 1:221156013-221156035 CCGCATGTTGATCTAGTTGCAGG + Intergenic
922108897 1:222538491-222538513 CTGCCTCTTGATATGGTTGGTGG + Intronic
922485009 1:225967144-225967166 CTGTTTCTTGATCTGGATGCTGG + Intergenic
923070522 1:230560244-230560266 CTGTGTCTTGATCTGGCTGGTGG + Intergenic
923617197 1:235547798-235547820 CTGTTTCTTGATCTGGTTGCCGG - Exonic
923751872 1:236754059-236754081 CTCCATCTTGTTCTGGATCCAGG - Exonic
924307581 1:242706952-242706974 CTATTTCTTGATCTGGATGGTGG + Intergenic
924730059 1:246702873-246702895 CTGTATCTTGATCTGAGTGGTGG + Intergenic
1063017573 10:2094181-2094203 CTGTATCATGATCCGGATGGTGG - Intergenic
1063218136 10:3942513-3942535 CTGCGTCTTGGTCTCGAAGCCGG - Intergenic
1063613331 10:7581569-7581591 CTGTTTCTTGATCTGGGTCCAGG + Intronic
1063939711 10:11115112-11115134 CTGCATATTAATCTGCATCCTGG - Intronic
1063985630 10:11498558-11498580 CTGCATCTTGGCATGGTTGCAGG + Intronic
1064514811 10:16135308-16135330 CTGTATCTTGATCTGGACAACGG + Intergenic
1065403683 10:25337253-25337275 CTCTATGTTGATCTGGATGGTGG - Intronic
1065612452 10:27485517-27485539 CTGTTTCTTGTTCTGGATGCTGG - Intergenic
1065865587 10:29912517-29912539 CTCCCTCTTGATCTAGATGCTGG + Intergenic
1067266172 10:44747455-44747477 CTGCATCTGAATATGGTTGCAGG + Intergenic
1067681531 10:48444978-48445000 CAGCATCAAGGTCTGGATGCCGG - Intergenic
1067933537 10:50587850-50587872 CTGTTTCTTAATCTGGGTGCTGG + Intronic
1068501821 10:57848720-57848742 CTATATATTGATCTGTATGCTGG - Intergenic
1068909699 10:62366133-62366155 CTGTTTTTTGATCTGGATGCTGG + Intergenic
1069025588 10:63537462-63537484 CTGCTTCTTAAGTTGGATGCCGG + Intronic
1069805438 10:71119935-71119957 TTGCATTTTCATCTGGATGTTGG - Intergenic
1071904828 10:90161304-90161326 CTTCCTCTTGATCTTGAGGCAGG + Intergenic
1072259060 10:93649966-93649988 CTGCATCTTGATTGTGGTGCTGG - Intronic
1072468276 10:95687873-95687895 CTGTAACTTGATCTGGATAGTGG - Intronic
1072484170 10:95838682-95838704 CTGTATCTTGATCTGGGTGGTGG + Intronic
1072534444 10:96350997-96351019 CTGTTTCTTGATCTGGGTGTTGG - Intronic
1073171759 10:101515983-101516005 CTGTTTCTTGATCTGGGTGTTGG + Intronic
1073183020 10:101597389-101597411 CTGCAGCTTCAACTGGATGCAGG - Intronic
1073492638 10:103864252-103864274 CTCCACCTTGATCTGGGTGGAGG + Intergenic
1074148408 10:110737495-110737517 CTGTTTCTTGATCTGGATGCAGG - Intronic
1075547973 10:123369829-123369851 CTGTTTCATGATCTGGGTGCTGG + Intergenic
1075718312 10:124569893-124569915 CTACATCTTGATCTGTGTGGGGG - Intronic
1077649290 11:3955279-3955301 CTGCATCTTGATTGGGGTGGTGG + Intronic
1077928061 11:6702122-6702144 CCGTAACTTGATCTGGATGCTGG + Intergenic
1078561071 11:12373034-12373056 CTGTTTCCTGATCTGGATACTGG - Intergenic
1078731306 11:13976777-13976799 CTGTTTCTTGATCTGGGTGCTGG - Intronic
1078734755 11:14009782-14009804 CTGCATCTTCATGTGGAGGAAGG + Intronic
1079456932 11:20644759-20644781 CTATATCTTGATTTGGGTGCTGG - Intronic
1080414807 11:32059431-32059453 CTGCTTCTTGATCTGAGTGCTGG + Intronic
1081102596 11:39023616-39023638 CTAGTGCTTGATCTGGATGCTGG + Intergenic
1081719848 11:45280587-45280609 CTGCCTCTTGACGTGGGTGCTGG - Intronic
1081975496 11:47231932-47231954 CTGCATCCTGATTTGGGTGGTGG + Intronic
1082819122 11:57531926-57531948 TTATATCTTGATCTGGATGGCGG - Intergenic
1084407170 11:68980830-68980852 CAGCATGGTGATCTGGCTGCTGG - Exonic
1085358900 11:75867256-75867278 CTATTTGTTGATCTGGATGCTGG - Intronic
1086095038 11:83041632-83041654 CTGTTTCTTAATCTGGATACTGG + Intronic
1086584857 11:88438976-88438998 CTGTACTTTGCTCTGGATGCTGG - Intergenic
1089283747 11:117392503-117392525 CTGTATCTTCTTCTGGAGGCTGG - Exonic
1089319278 11:117613938-117613960 CTGTATCCTGATCTGGCTGCTGG + Intronic
1090204052 11:124875250-124875272 TTGCACCTTGATCTGGATTTGGG - Exonic
1090751748 11:129752208-129752230 CTGAATGTTGATCTAGGTGCTGG + Intergenic
1090772899 11:129937161-129937183 CTGTTTCTTGATCTGGGTGCAGG + Intronic
1091773112 12:3166659-3166681 CTGTTTCTCAATCTGGATGCTGG - Intronic
1092295683 12:7198312-7198334 CTGTATCTTGATCCGGGTGGTGG + Intronic
1092834033 12:12471353-12471375 CTGCATCTAGAAATGGAAGCAGG - Intergenic
1092945801 12:13452936-13452958 CTCCATCTTTATGTGGATGGGGG - Intergenic
1093411785 12:18876891-18876913 CTGCTTCCTGAACTGAATGCAGG + Intergenic
1095350571 12:41205820-41205842 CTGTTTCTTGATCTGGGTGCTGG - Intronic
1095758706 12:45801865-45801887 GTGTATCTGGATCTGGATGAAGG + Intronic
1096661722 12:53129427-53129449 CTTAATCTTAATCTGCATGCAGG + Intergenic
1097342663 12:58456556-58456578 GTGCATCTTGATCTGAATTCTGG + Intergenic
1097527303 12:60753277-60753299 CTGCATTTTGATCTGAAGACTGG - Intergenic
1098080706 12:66782102-66782124 CTACTTCTTGATCTGGATGCTGG + Intronic
1098539682 12:71640412-71640434 CTGCATCTTGATCTGGGCTGGGG - Intronic
1099457076 12:82876756-82876778 CTTTATCTTGATCAGGCTGCTGG + Intronic
1100505922 12:95220146-95220168 CCGTTTCTTGATCTGGGTGCTGG - Intronic
1101112031 12:101495673-101495695 CTGTATTTTGGTCTGGATGTTGG - Intergenic
1101525545 12:105525382-105525404 CTGGTCCTTGATCTGGTTGCTGG - Intergenic
1101981815 12:109414057-109414079 CTGCTTCTTAATCTGGGTGCTGG + Intronic
1102189822 12:110979188-110979210 CTGTATCTTGATGTGAGTGCTGG - Intergenic
1102392520 12:112560801-112560823 CTGTCTCTTGACCTGAATGCTGG - Intergenic
1103317684 12:120069779-120069801 CTGTATCTTGATCTCCATGGTGG - Intronic
1103335345 12:120185173-120185195 CTACTTCTTGATCTGGGTGCTGG + Intronic
1103994946 12:124823155-124823177 CTGTTTCCTGATCTGGTTGCTGG + Intronic
1106198286 13:27512892-27512914 CTACATCTTGCTCTGGATGATGG - Intergenic
1106559641 13:30837192-30837214 CTGCATCTTGACCTTGGTGATGG + Intergenic
1106738664 13:32615034-32615056 TTGTCTCTTGATCTGAATGCTGG - Intronic
1107091864 13:36490092-36490114 CAGCATCTTGGCCTGGATGTTGG + Intergenic
1107374058 13:39782937-39782959 CTGTTCCTTGATCTGGATGATGG + Intronic
1107992264 13:45829293-45829315 CTATATCTTGATCTGGGTGGTGG - Intronic
1108077069 13:46692268-46692290 CTGTTTCTTGAACTGGAAGCTGG - Intronic
1108240936 13:48463255-48463277 TTGTTTCTTGATCTGGATGCTGG - Intronic
1108505800 13:51111255-51111277 CCGCCACTTGATCTAGATGCGGG + Intergenic
1110947660 13:81443554-81443576 CTGCATTCTCATCTGGAGGCAGG + Intergenic
1111121471 13:83856499-83856521 CTTCCTCTTGATATGGATACAGG + Intergenic
1111313843 13:86525538-86525560 CTGCATCTTGATTTGGGTACTGG + Intergenic
1111862854 13:93730037-93730059 CTGCTTCTTGCCCTGGGTGCTGG + Intronic
1112314223 13:98346847-98346869 CTCTCTCTTGATCTGGATGCTGG + Intronic
1112597232 13:100818627-100818649 CAGCATCTTGATCTGGAAGTTGG + Intergenic
1113679327 13:112231950-112231972 CTGCACCCTAATCTGGGTGCTGG + Intergenic
1114420551 14:22578722-22578744 CTGCATCTTGATCTGGATAGTGG + Intronic
1115917244 14:38329579-38329601 CTACGTCTTGATCTGGTGGCTGG + Intergenic
1117113866 14:52489703-52489725 CTGTATCTTAATCTGTATGGTGG - Intronic
1117288641 14:54311230-54311252 CTGCTGCTTGATCTGGGTGTTGG - Intergenic
1117905915 14:60586403-60586425 CTCCTTCTTGATCTGGATGTTGG - Intergenic
1118150545 14:63184692-63184714 CTGTATCTTGATTGGGATGTGGG - Intergenic
1118195857 14:63625349-63625371 CTGTATCTTAATCAGGGTGCTGG + Intronic
1118457020 14:65953908-65953930 TTGTTTCTTGATCTGGGTGCTGG - Intergenic
1118761423 14:68882458-68882480 CTCCATCTTGGTCTGGATCCAGG + Exonic
1119956496 14:78803775-78803797 CTGCGTCTGGAGCTGGATGGGGG + Exonic
1120176881 14:81303916-81303938 TTGTTTCTTGATCTGGGTGCTGG - Intronic
1120840369 14:89080233-89080255 CTGCATCTTGGTCTGGATCCTGG + Intergenic
1121057091 14:90865503-90865525 CCTCATCTTGATCTGAATGATGG + Exonic
1121088649 14:91166164-91166186 TTGTTCCTTGATCTGGATGCTGG + Intronic
1121238300 14:92409572-92409594 TTGTTTCTTGACCTGGATGCTGG - Intronic
1121582706 14:95042961-95042983 CTGTATCTTGATTGTGATGCTGG + Intergenic
1121926784 14:97934294-97934316 CTGCATGATGATTTGAATGCAGG - Intronic
1122112569 14:99512669-99512691 CTGACTCTTGATCTTGAAGCCGG - Exonic
1122490064 14:102109062-102109084 CTGCATCTTGAGCTGGGTGTTGG - Intronic
1122513447 14:102288823-102288845 CTGCTTCTTGATCTGGAAGCAGG + Intronic
1122992871 14:105246838-105246860 CAGCGTCTTGATCTGCATGGTGG - Intronic
1125689072 15:41581964-41581986 CTGTTTCTTAATCTGGATGCTGG - Exonic
1126155067 15:45558262-45558284 CTGCTTCTGGGTTTGGATGCAGG + Intergenic
1126526844 15:49665580-49665602 CTGTTTCTTGATCTGGGTGCTGG + Intergenic
1127611059 15:60637508-60637530 CTGCATATTTATCTAGATACAGG - Intronic
1127832665 15:62764643-62764665 TTGTTTCTTGATCTGGCTGCCGG - Intronic
1127937541 15:63656652-63656674 CTGTTTCTTGATCTGGAGGGCGG - Intronic
1129222820 15:74142895-74142917 CTATACCTTGATCTGGATGGTGG + Intergenic
1129754715 15:78090939-78090961 CTGTTTCTTGATCTGGTTGGTGG - Intronic
1129828960 15:78654807-78654829 CTGTGTCTTGAGCTGGATGCTGG - Intronic
1130247458 15:82264787-82264809 CGGCATCTTGATTTGCAAGCTGG - Intronic
1130511161 15:84590495-84590517 CTGTATCTTGAACTGAATGATGG - Intergenic
1130567291 15:85007433-85007455 TTGCTTCTTGATCTGGGTGCTGG + Intronic
1130683731 15:86018983-86019005 CTGCATTTTAAGCTGGATGTTGG + Intergenic
1130884595 15:88082452-88082474 CTGCATTTTCATCTGGGTGGTGG - Intronic
1131152099 15:90053716-90053738 CTTCATCCTGATGTGGGTGCCGG + Intronic
1131253753 15:90847853-90847875 CCGCTTGTTGATCTGGATGCTGG - Intergenic
1133371923 16:5251737-5251759 TTGTATTTTGATCTGGATGATGG + Intergenic
1133747769 16:8700407-8700429 CTAGATCTTGATCTAGGTGCTGG - Intronic
1134009632 16:10842429-10842451 CTGTTTCTTGGTCTGGATGCTGG - Intergenic
1134795561 16:17032606-17032628 TTGTTTGTTGATCTGGATGCTGG - Intergenic
1135209622 16:20513271-20513293 CTGCATCTTGGTGGTGATGCTGG + Intergenic
1135224610 16:20645028-20645050 GTGCATCTTGATGGGGAAGCTGG + Intronic
1135661926 16:24304452-24304474 CTATTTCTTGATCTGGACGCTGG - Intronic
1137376243 16:47954404-47954426 CCGCACCTTGATCCTGATGCTGG - Intergenic
1137699574 16:50487257-50487279 CTGTTTCTTGAGCTGGAAGCTGG + Intergenic
1137996391 16:53219073-53219095 TTGTTTCTTGATCTGGAAGCTGG + Intronic
1138603131 16:58069418-58069440 CTGTTTCTTGATCTGGGTGCTGG + Intergenic
1138639788 16:58375714-58375736 CTGTTTCTTGATCTTGGTGCTGG - Intronic
1138989119 16:62369160-62369182 CTGATTCTTGGTCTGAATGCTGG + Intergenic
1139363788 16:66420357-66420379 CTGTTTCTTGAGCTGGGTGCTGG - Intergenic
1140618432 16:76696079-76696101 TTGTTTCTTGATGTGGATGCTGG - Intergenic
1141350433 16:83289924-83289946 CTGCTTCTTAATCTGGGTGCTGG - Intronic
1141409974 16:83826442-83826464 CTGCCTCTTTATTTGCATGCAGG - Intergenic
1143083881 17:4401457-4401479 TTGTATCTTGATCTGGGTGGCGG + Intergenic
1143235051 17:5392577-5392599 CTGATTCTTGACCTGGATACTGG - Intronic
1143848627 17:9792607-9792629 CTGTTTCTTGATCTGCATGCTGG - Intronic
1144287835 17:13795670-13795692 TTGCATCTTCATCTGTATGTTGG + Intergenic
1144637206 17:16917840-16917862 CTGCTTCATGATCTGGGGGCTGG + Intergenic
1144783828 17:17821062-17821084 CTGTAGCTTGATGTGGATGGTGG + Intronic
1145059516 17:19723954-19723976 CTGTTTCTTGATCTGTCTGCTGG - Intergenic
1145243777 17:21254349-21254371 CTGTATTTTGATTTGGATGGTGG - Intergenic
1146794470 17:35771523-35771545 CTGTTTCTTGATTTGGGTGCTGG + Intronic
1147379793 17:40047319-40047341 CTGTATCTTATTTTGGATGCTGG + Intronic
1147485858 17:40813244-40813266 CTGTATCTTGATTTGGGTGGTGG + Intergenic
1148732199 17:49844122-49844144 CTGCAGCTGGAGCTGAATGCTGG + Exonic
1149169945 17:53797172-53797194 CTGTTTCTTGATCTGAGTGCTGG + Intergenic
1149586972 17:57796653-57796675 CTGTTTCTTGATATGGGTGCTGG - Intergenic
1150305018 17:64077381-64077403 CTGTTTCTTCACCTGGATGCCGG - Intronic
1151039324 17:70840253-70840275 CAGCATCTGGAGCTGGAAGCAGG + Intergenic
1151775190 17:76196411-76196433 CTACTTCTTCATCTGAATGCTGG + Intronic
1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG + Intergenic
1152113213 17:78368738-78368760 CTTCAGCTTGAGCTGGAAGCAGG - Intergenic
1152767989 17:82151306-82151328 GTGCATCTGGTTCTGGGTGCGGG - Intronic
1153049764 18:890721-890743 CTACACCTTAATCTGGATGATGG - Intergenic
1153092095 18:1358573-1358595 CTGGTCCTTGATCTGGGTGCTGG + Intergenic
1153558891 18:6349880-6349902 ATGTTTCTTGATCTGAATGCTGG + Intronic
1153737642 18:8088463-8088485 CTGTTTCTTGATTTGGATTCTGG - Intronic
1153767871 18:8391642-8391664 TTGTATCTTGATCTGAATGGTGG + Intronic
1153959141 18:10125427-10125449 CTGTTTCTTGATCTGGGAGCTGG - Intergenic
1154148341 18:11885195-11885217 CAGCATCATGAGCTGGATGCAGG + Exonic
1154331253 18:13430580-13430602 CTGTGTCTTGATCAGGGTGCTGG + Intronic
1154978419 18:21481588-21481610 CTGTTTCTTGATCTGAGTGCTGG - Intronic
1155097965 18:22578099-22578121 CTGTATCCTAATCTGGATGGTGG - Intergenic
1155176985 18:23309396-23309418 CTGTTTCTTGCTCTGGATGCTGG + Intronic
1155553306 18:26990388-26990410 CTGTTTCTTGATCTGCATGCTGG + Intronic
1157541504 18:48514042-48514064 CTACAGCTTGATCTGGGTGGCGG - Intergenic
1158420898 18:57292879-57292901 CTGTTTCTTGATCTGGATGTTGG + Intergenic
1158821219 18:61161204-61161226 CTGCCTCCTGAGCTGAATGCAGG + Intergenic
1159178722 18:64873459-64873481 GTGCATCTTTATCTAGATGTTGG - Intergenic
1159492021 18:69148728-69148750 CTGCATCATGACCTGAATGTGGG + Intergenic
1160273930 18:77412576-77412598 CAGGGTCTTGATCTGGATGTTGG - Intergenic
1163272236 19:16261247-16261269 CTGTTTCTTGAGCTGGCTGCTGG + Intergenic
1164694664 19:30234317-30234339 CTGGCTCTTCAGCTGGATGCTGG + Intronic
1165224013 19:34341436-34341458 TTGCAGCTGGATCTGTATGCAGG - Exonic
1165829756 19:38724543-38724565 CTCCATCTTGGTCTGGATCCAGG - Exonic
1165986711 19:39775982-39776004 CTGTTTCTGGATCTGGGTGCTGG + Intergenic
1166200837 19:41237090-41237112 CTGTGTCTTGATTTGGATGGTGG - Intronic
1166203834 19:41256050-41256072 CTGTTTCTTAATCTGGGTGCTGG + Intronic
1166865586 19:45834669-45834691 CTGTATCTTGATCTGGGTGATGG + Intronic
1167218454 19:48181203-48181225 CTGTTTCTTGTTCTGGGTGCTGG - Intronic
1167450486 19:49565359-49565381 TTGTTTCTTGATCTGGGTGCTGG + Intronic
1168374409 19:55863730-55863752 CTGTTTCTTGACCTGGATACTGG + Intronic
1168637382 19:58007092-58007114 CTATATCTTGATCTGGGTGGTGG + Exonic
925744581 2:7033316-7033338 CTGGTGCTTGATCTGGCTGCTGG + Intronic
927355485 2:22168045-22168067 TTCCATCTTGATTTTGATGCAGG - Intergenic
927831708 2:26357102-26357124 CTGTATCTTGAGCTGGGTGGTGG - Intronic
928145708 2:28773098-28773120 CTGTACCTTGATCTGGATGATGG + Intronic
928380104 2:30810267-30810289 GTGTTTCTTAATCTGGATGCCGG - Intronic
928538057 2:32258900-32258922 TTGCATCTTCATCCTGATGCAGG - Intronic
928991317 2:37235369-37235391 CTGTTTCTTGATTTGGGTGCTGG - Intronic
929103469 2:38340227-38340249 CTGTATTTTCATCTGGATGGTGG + Intronic
929342559 2:40839230-40839252 CTATATCTTGATCTTGATGATGG - Intergenic
930680381 2:54251499-54251521 TTGTGTCTTGATCTGGGTGCTGG - Intronic
932040670 2:68295793-68295815 CTGTATCTTGATTGGGATGGTGG + Intronic
932313196 2:70760690-70760712 CTGCTTCTTGACCTGCATGGTGG + Intronic
932538310 2:72623043-72623065 CGGTATCTTGATCTGGGTGCTGG + Intronic
932610902 2:73199316-73199338 CTATTTCTTCATCTGGATGCTGG - Intergenic
932692393 2:73924443-73924465 CTGTTTCTTGATCTGAATCCAGG + Intergenic
935313136 2:101805202-101805224 CTGTTTCTTGATCTAGGTGCTGG - Intronic
935640730 2:105287579-105287601 CTGCATCTTCATCTTTATACAGG + Intronic
936110863 2:109663419-109663441 CTGCTTCTTGTCCTGGGTGCTGG + Intergenic
936683214 2:114798706-114798728 CTGTTTCTTGCTCTGGATTCTGG + Intronic
937103276 2:119288061-119288083 CTGCATCTTGACTTAGATGTGGG + Intergenic
937153973 2:119705324-119705346 CTGCATTCTCATCTGGAGGCTGG + Intergenic
937306930 2:120877458-120877480 CTGTCTCTTGATCTGGGTGCTGG - Intronic
937939048 2:127270950-127270972 CTGGAACTTGATCAGGAGGCAGG - Intronic
938186448 2:129236409-129236431 CTGCATCATGATATGGTTGAAGG - Intergenic
938402981 2:131008444-131008466 CTATTTCTTGATCTGGATGTTGG - Intronic
938982689 2:136541520-136541542 CTGTTTCTTGATCTGGGTGCTGG + Intergenic
940061073 2:149568830-149568852 CTGTGTTTTGATCTGGGTGCTGG + Intergenic
940097689 2:149996385-149996407 CTGTTTCTTGATTTGGGTGCTGG + Intergenic
940754582 2:157667375-157667397 CTGTATCTTGATCTAGGTGTTGG + Intergenic
941251218 2:163165899-163165921 CTGTTTCTTGATCTGGATACTGG - Intergenic
942571163 2:177315788-177315810 CTGTTTCTTGATCTGGGTGCTGG + Intronic
943044964 2:182849283-182849305 CTTTATCTTGATCTGGATGATGG + Intronic
943282573 2:185955838-185955860 CTGCTTTTTGATCTAGGTGCTGG - Intergenic
944332480 2:198487929-198487951 CTGCATTTTGATCTGAGTGGGGG - Intronic
944666907 2:201966476-201966498 CTATAGCTTGATCTGGATGGTGG - Intergenic
945573710 2:211503657-211503679 CTGCTTCTTGGGCTGGATGCTGG + Intronic
946059079 2:216926412-216926434 CTGCTTTTTCATCTGGATGATGG - Intergenic
946235135 2:218319846-218319868 CTGTATCTTGAGCTGAGTGCTGG - Intronic
946397027 2:219448351-219448373 CTGCAGCTTGTCCAGGATGCGGG - Exonic
947043037 2:225946311-225946333 TTGTTTTTTGATCTGGATGCTGG - Intergenic
948257847 2:236580957-236580979 CTGCATCCTGGTGTGGCTGCTGG + Exonic
1169223554 20:3841541-3841563 CTAGATGTTGATCTGGATGCTGG + Intergenic
1169270050 20:4192251-4192273 CCACATCTTGATCTGGGTGGCGG + Intergenic
1169308103 20:4511174-4511196 CTACATCTTGATCTGGGTGATGG - Intergenic
1169468924 20:5866375-5866397 CTGTTGCTTGATCAGGATGCTGG - Intergenic
1169825724 20:9766817-9766839 CTGCTTTTTGATTTGAATGCTGG + Intronic
1170024797 20:11877239-11877261 CTGGTTCTTGATCTGGATGCTGG + Intergenic
1170517404 20:17145671-17145693 CTGTTTCTTGATCTACATGCTGG + Intergenic
1170548960 20:17459196-17459218 CTGTTTCTTGATTTGGGTGCTGG - Intronic
1170807596 20:19646659-19646681 CTCCCTCTTGATCAGGGTGCTGG - Intronic
1170832720 20:19857060-19857082 CTAGACCTTGATCTGGATGGTGG - Intergenic
1171182870 20:23103791-23103813 CTGCTTCTTGATCTAGGAGCTGG - Intergenic
1172157146 20:32835554-32835576 CTGCATCTTGATCTATTTTCAGG + Intronic
1172470815 20:35193478-35193500 CTGTTTCTTAATCTGGATGCTGG + Intergenic
1172615832 20:36283561-36283583 CTATATCTTGATCTGGATGATGG - Intergenic
1172984527 20:38973401-38973423 CTGCTTCTTGATCTGGGTGCTGG - Intronic
1173136055 20:40440103-40440125 CTTTGTCTTGATCTGGGTGCTGG + Intergenic
1173533575 20:43790411-43790433 CTATATCTTGATCTAGATGATGG - Intergenic
1173624273 20:44460260-44460282 TTACATCTTGATCTGGATGGAGG + Intronic
1173668378 20:44779338-44779360 CTGCTTCTTGATCTGGGTGCTGG - Intronic
1174434250 20:50494261-50494283 CTGTATCTTGATCTGGGTGCAGG + Intergenic
1174539166 20:51275670-51275692 CTGCCTCCTGGTCTGGATGATGG + Intergenic
1175203396 20:57292843-57292865 CTGCACCTGGGGCTGGATGCCGG + Intergenic
1175332376 20:58174327-58174349 CTGTTTCTGAATCTGGATGCCGG + Intergenic
1177327826 21:19615132-19615154 CTGAATCTTGACCTGCCTGCAGG - Intergenic
1178165753 21:29974381-29974403 CTGCATCTTAATTTTGATGGTGG + Intergenic
1178912378 21:36685815-36685837 CTATATCTTGATCTGGGTGGTGG - Intergenic
1178960874 21:37063804-37063826 CTACATCTTGATCTGGGTGGTGG - Exonic
1179161006 21:38899167-38899189 CTGAATCTTGATTGGGATGATGG + Intergenic
1179362143 21:40719852-40719874 CTTTTTCTTGATCTGGGTGCTGG + Intronic
1180723357 22:17926068-17926090 TTTCATCTTGACCTTGATGCTGG + Intronic
1181149540 22:20873408-20873430 CTACATCTTGATCTGGGTGGTGG - Intronic
1181843164 22:25682767-25682789 CCGTCTCTTGATCTGGGTGCCGG - Intronic
1183217700 22:36491690-36491712 CAGCATCTATTTCTGGATGCTGG - Intronic
1183428908 22:37754098-37754120 CTGCTTCTTGAACTGTAGGCTGG - Intronic
1183809832 22:40246146-40246168 CAGTTTCTTGTTCTGGATGCTGG - Intronic
1183971556 22:41481401-41481423 CTGTAGCTTGCTCTGTATGCTGG + Intronic
1184557998 22:45243586-45243608 CTGTTTCTTGATCTGGGGGCTGG + Intergenic
1184793596 22:46717708-46717730 CTGCTCCTTTATCTGGGTGCTGG + Intronic
1184985019 22:48125758-48125780 CTGCTTCTTGATCCTGGTGCTGG + Intergenic
1185187197 22:49408117-49408139 CTGCATATTAAACTGGAAGCAGG - Intergenic
949597226 3:5560855-5560877 CTGTTTCTTGATCTGGAGTCTGG - Intergenic
950232178 3:11285567-11285589 CTGTATCTTGAGCTGGGTGGTGG - Intronic
950322633 3:12070762-12070784 CTGCATCTGGACCTGGCTGGTGG + Intronic
950481601 3:13247727-13247749 CTGGATCTGGATCTGGAGGGAGG + Intergenic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
950793269 3:15490374-15490396 CTGTTTCTTGACCTGGGTGCTGG - Intronic
951782344 3:26377816-26377838 CTGTATCTTCATCTGGGTGATGG + Intergenic
951824616 3:26854597-26854619 CTGCTTCTTAATTTGGGTGCTGG - Intergenic
952329675 3:32352740-32352762 GTGTTTCTTGATTTGGATGCTGG + Intronic
952536317 3:34313223-34313245 CTATATCTTGATCTGGGTGTTGG - Intergenic
952690524 3:36199874-36199896 CTGTTTCTTGATCTGGGTTCTGG + Intergenic
952737487 3:36704920-36704942 CTGCATCTTCATCGGGAATCAGG - Intergenic
952859525 3:37801349-37801371 CTGTTTCTTGATCTGAGTGCTGG + Intronic
953163313 3:40442305-40442327 CTGTATTTTGGTCTGGATGGTGG + Intergenic
953384161 3:42496432-42496454 CTGCAACTTGCTTTGGTTGCTGG + Intronic
953646952 3:44764197-44764219 CTATTTCTTGATCTGGATGGTGG - Intronic
953660582 3:44888750-44888772 CTCCACCTTGATCTGGCTGGTGG - Intronic
953702024 3:45203979-45204001 CTGATTCTTGATCTGGGTGCTGG + Intergenic
953746855 3:45581415-45581437 CTACTTCTTGATCTGGGTTCAGG + Intronic
953758680 3:45669513-45669535 CTATATCTTGATCTGGGTGGTGG - Intronic
954323915 3:49851279-49851301 CTGTTTCTTGATCTGAATTCTGG + Intronic
954376076 3:50194786-50194808 CTGCACCTTGATGTAGTTGCCGG - Exonic
954692418 3:52402611-52402633 CTGCACCTTTATCTCCATGCTGG - Exonic
955178078 3:56637214-56637236 CTACATCTTGATTTGGGTGATGG + Intronic
956023212 3:64954494-64954516 CTGCTTCTTGATCTGGATGCTGG + Intergenic
956168860 3:66417044-66417066 CTGCATCCAGAACTGGGTGCCGG + Intronic
956781942 3:72610623-72610645 CTGCTTCTTGATCTTAGTGCTGG + Intergenic
959280531 3:104332625-104332647 GTGTCTCTTGATCTTGATGCTGG + Intergenic
960870509 3:122244654-122244676 CTGTTTTTTGATTTGGATGCTGG + Intronic
961016068 3:123469316-123469338 CTGTTTCTTGATCTGGATGCTGG + Intergenic
961072768 3:123950690-123950712 CTGTATCTTGATCTAGGTGGTGG + Intronic
962056591 3:131878524-131878546 CTGTTTCTTAATCTGGATGCTGG + Intronic
962430566 3:135315165-135315187 ATGCTTCTTGATCTGGGTGCAGG + Intergenic
962838308 3:139209308-139209330 ATATATCTTGATCTGGATGGTGG + Intronic
963710476 3:148741479-148741501 CTGCATCATCATTTGGCTGCTGG + Exonic
963842463 3:150121588-150121610 TTGCTTCTTGCTCTGGGTGCTGG + Intergenic
964026159 3:152077602-152077624 CTGCATCATGATCTAGAAGTGGG - Intergenic
966328616 3:178785655-178785677 CTGTTTCTTGACTTGGATGCTGG + Intronic
966936688 3:184714927-184714949 CTGTGTCTTGATTTGGATGTAGG + Intergenic
967439212 3:189487621-189487643 CTGTTTCTTGATTTGGATGCTGG + Intergenic
967834441 3:193949046-193949068 CTGCTTTTTGTTCTGGGTGCTGG - Intergenic
969135822 4:5027927-5027949 CAGCCTCTGGATCTGGAAGCAGG - Intergenic
969272548 4:6112737-6112759 CTGGAACTCGATCTGAATGCTGG + Exonic
969310693 4:6351639-6351661 CTGCAGGGTGATGTGGATGCAGG - Intronic
971972779 4:33641678-33641700 CTGCAGTTTGATTTGGATTCTGG + Intergenic
972456178 4:39257917-39257939 CTATATCTTGATCTGGGTGGGGG - Intronic
972561770 4:40235257-40235279 TTGCTTCCTGATCTGGATGCTGG - Intronic
972902610 4:43703311-43703333 CTGCATCTTCATCTGCATTAGGG + Intergenic
974811241 4:66949002-66949024 CTGTTTCTTGATCTGGGTGCTGG - Intergenic
975155558 4:71068411-71068433 CTGTATTTTGATCTGGGTGGTGG - Intergenic
975492184 4:75001522-75001544 CTGTATCTTGATCTTGCTGGCGG + Intronic
975615904 4:76246624-76246646 CTACATCTTGATCTAGTTGGTGG - Intronic
976251946 4:83061287-83061309 TTGTTTCTTGTTCTGGATGCTGG - Intronic
976411597 4:84719771-84719793 CTGTTTCTTGGTCTGGATGCTGG - Intronic
977122573 4:93121265-93121287 CTGTTTCTTGATCTGGATGATGG - Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
978946103 4:114498834-114498856 CTGCTTCTTGATCAGGGTGATGG - Intergenic
979099622 4:116598873-116598895 CTCCATCTTGGTCTGGATCCAGG - Intergenic
979150764 4:117311249-117311271 TTGCATCATGATCTCTATGCAGG + Intergenic
979389112 4:120106440-120106462 CTGCAACTTGATCTTGAGGTAGG - Intergenic
979482330 4:121234456-121234478 CTGCTTCTTGATGTGGGTGCTGG - Intergenic
979525409 4:121710995-121711017 CTATATCTTGATATGGATGATGG + Intergenic
979637068 4:122968375-122968397 CTGTATCTTGATCTGAGTGGTGG - Intronic
980156398 4:129112528-129112550 TTGTATTTTGATCTGGATGATGG + Exonic
980444101 4:132884557-132884579 CTGCATCTTGATAGGGCAGCTGG + Intergenic
981362906 4:143867538-143867560 CTCTATCTTGATCTGGGTGGTGG - Intergenic
981373633 4:143988342-143988364 CTCGATCTTGATCTGGGTGGTGG - Intergenic
982010229 4:151099071-151099093 CTGCTTGTTGATGTGGATGCTGG - Intergenic
985527853 5:416090-416112 CTGCACCTTCACGTGGATGCTGG - Intronic
986694377 5:10339020-10339042 CTATATCTTGATCTGGATGTTGG + Intergenic
987052977 5:14163636-14163658 CTGCATCCTGATTGGGATTCTGG + Intronic
987119775 5:14756097-14756119 CTGTAACTTGATCTGGTGGCTGG + Intronic
987588978 5:19897927-19897949 CTGTTTCTTTATCTGGATGAAGG + Intronic
988300938 5:29425928-29425950 CTGCATCTTTATTTTGATGCTGG + Intergenic
989115276 5:37946499-37946521 CTACTTCTTTATCTGGATGGCGG - Intergenic
989119321 5:37988522-37988544 GTGTTTCTTGATCTGGATGCTGG - Intergenic
989227190 5:39042826-39042848 CTGTTTCTTGATCTGGGTTCTGG + Intronic
992087727 5:73293049-73293071 CTGTTTCTTGATCTGGCTGCTGG + Intergenic
993784722 5:92115941-92115963 TTGCATCTTGAAATGGCTGCTGG + Intergenic
996674785 5:126161590-126161612 CTGTGTCTTAATCTGGGTGCTGG + Intergenic
996696811 5:126406464-126406486 CTGCATATTGATCTAGGTGGTGG - Intronic
997196172 5:131981441-131981463 CTATGTCTTGATCTGGGTGCTGG - Intronic
997259967 5:132458203-132458225 CTGTTTCATGATTTGGATGCTGG - Intronic
997367344 5:133334514-133334536 CTGTCTTTTGATCTGGGTGCTGG + Intronic
997658542 5:135573146-135573168 GGGCATCTTGATCTGATTGCTGG - Intronic
998253472 5:140567860-140567882 CTGAATCTAGGTCTGCATGCTGG + Exonic
999851326 5:155542498-155542520 CTGTTTCTTGATCTGGATTATGG - Intergenic
1000320002 5:160126810-160126832 CTGATTCTTGATCTGGGTACTGG + Intergenic
1001448292 5:171804622-171804644 CTATATCTTGATCTGTATGATGG + Intergenic
1002577187 5:180180817-180180839 CTGCTTCTCAATCTGGGTGCTGG - Intronic
1005329450 6:24735058-24735080 CTGTATCTTGATATGGATTTGGG + Intergenic
1005560928 6:27039957-27039979 CTGTTTCTTGATCTGAGTGCCGG + Intergenic
1005757193 6:28935425-28935447 TTTCCTCTTGATCTGGATGGTGG - Intergenic
1006010559 6:31039645-31039667 CTGCATCCTCATCTGGAGGCTGG + Intergenic
1006172998 6:32106165-32106187 TTGTTTCTTGATCTGGATGACGG + Intronic
1006527099 6:34615896-34615918 CATCATCTTGATGTGGATGTTGG + Intronic
1006732812 6:36248918-36248940 CTGCTTGTTGCACTGGATGCTGG + Intronic
1006946640 6:37788832-37788854 CTCTATCTTGATCTGGGTGATGG - Intergenic
1006947190 6:37792533-37792555 CTGTATCTTGATGTGGAGGGCGG - Intergenic
1008090418 6:47288433-47288455 CCGTAACTTGATCTGGATGCTGG + Intronic
1009004178 6:57761835-57761857 CTGCATCTTTATTTTGATGCTGG + Intergenic
1009879605 6:69549633-69549655 CTGTATCTTTGTCTGTATGCTGG - Intergenic
1013297735 6:108774618-108774640 CTGCATTCTGATCTGGAGGAGGG + Intergenic
1013321972 6:109001738-109001760 CTGCTTCTTTATCTGGATTCTGG - Intronic
1013954171 6:115821047-115821069 ATACATATTGATGTGGATGCGGG + Intergenic
1014164166 6:118204736-118204758 CTGTTTCTTGATTTGGATACTGG - Intronic
1015129608 6:129794588-129794610 CTGCTTCTGGATCTGAAGGCTGG - Intergenic
1015133045 6:129835834-129835856 CTGCATCTTGATGTGGAGATGGG + Intronic
1015767203 6:136731179-136731201 CTACTTCTTGATCTAGGTGCTGG + Intronic
1015948194 6:138524323-138524345 CTCTATCTTGATCTGGGTGCTGG - Intronic
1016583159 6:145652568-145652590 CTGCTTCTGGATCTAGGTGCTGG - Intronic
1016988716 6:149914117-149914139 GGGCATCTTGATCTGCATGGTGG + Intergenic
1018687397 6:166314534-166314556 CTGCATCTTGATGGGGCAGCTGG + Intergenic
1018760845 6:166893249-166893271 ATGCATCTTGATGGGGAAGCTGG + Intronic
1021154586 7:17194440-17194462 CTCTTTCTTGATCTGGGTGCTGG + Intergenic
1021667063 7:22994444-22994466 CTGTTTCTTGATCTAGGTGCTGG + Intronic
1021866088 7:24959580-24959602 CTGTTTCTTGTTCTGGACGCTGG + Intronic
1021976724 7:26018370-26018392 CTGAATCTTCATTTGAATGCAGG + Intergenic
1022280060 7:28899080-28899102 CTGTATCTTGATCTGAGTGGTGG + Intergenic
1022283833 7:28936265-28936287 CTATTTCTTGAGCTGGATGCTGG - Intergenic
1022526794 7:31043177-31043199 CTGAATCCTGATCAGAATGCTGG - Intergenic
1023873549 7:44275204-44275226 ATGCATCCTGAACTGGATGCAGG - Intronic
1023891658 7:44396826-44396848 CTGCATCTTGCACTGGGTGTCGG - Intronic
1024836132 7:53520870-53520892 ATGCAACTTGATCTTGATGATGG + Intergenic
1026640173 7:72117460-72117482 CTGCATTTTAATCTTAATGCTGG + Intronic
1026811326 7:73468626-73468648 CTTTCTCTTGATCTGGGTGCCGG - Intronic
1026973610 7:74482614-74482636 CTGTTTCTTGATCTGGGTGCTGG - Intronic
1027217095 7:76190862-76190884 CTGTTTCTTGAGCTGGGTGCTGG - Intergenic
1028846670 7:95488797-95488819 CTGTTTCCTCATCTGGATGCTGG - Intronic
1028885648 7:95929626-95929648 CTGAATCTTGATCTGAAGACTGG - Intronic
1029891970 7:103939940-103939962 CTGCTTGTTGAACTGGATGAAGG + Intronic
1029971500 7:104794006-104794028 CTGTTTCTTGAGCTGGGTGCTGG + Intronic
1030058668 7:105605502-105605524 CTACATCTTGAATTGGAAGCTGG - Exonic
1030337105 7:108339469-108339491 CTGCATCTTGATGGGGCAGCTGG + Intronic
1030447389 7:109664264-109664286 CTGTTTCTTAATCTGGGTGCTGG - Intergenic
1031385476 7:121145000-121145022 CTATATCTTAATCTGGGTGCTGG + Intronic
1031440139 7:121784566-121784588 CTTTATCTTGATCTGGATAGTGG + Intergenic
1031837796 7:126699743-126699765 CTGTCTCTTTATCTGGAGGCTGG - Intronic
1032009217 7:128331228-128331250 CTACATCTTGATCTGGGTGGTGG + Intronic
1033023267 7:137748750-137748772 CTGCATCATGATCTGTGTGATGG - Intronic
1034138726 7:148796815-148796837 CTGCATCTAGAGCAGGGTGCGGG - Intronic
1035970633 8:4244014-4244036 CTGCATTTTAACCTGGCTGCAGG + Intronic
1036742943 8:11381772-11381794 CTATATCTTGATCTGGATGGTGG - Intergenic
1038574869 8:28696307-28696329 CTGTTTCTTGAGCTGGGTGCTGG - Intronic
1039318255 8:36397598-36397620 TTACTTCTTAATCTGGATGCTGG - Intergenic
1039745117 8:40418402-40418424 CTGCATCCTGTTCTGGCTGGTGG + Intergenic
1041757576 8:61331054-61331076 CAGGATCTTGTTCTGGATCCTGG - Intronic
1043238758 8:77903574-77903596 CAGCATCCTCTTCTGGATGCTGG + Intergenic
1044596306 8:93962242-93962264 CTGTTTCTTGACCTGGGTGCTGG - Intergenic
1044958546 8:97506500-97506522 CTGCATCTTCATCTGCTGGCAGG - Intergenic
1045987643 8:108267308-108267330 CTCTATCTTGATCTGGTTGGCGG + Intronic
1046066664 8:109205374-109205396 CTGCATCTTGATTCTGCTGCTGG - Intergenic
1047125509 8:121955254-121955276 CTATTTCTTGATCTGGATTCTGG - Intergenic
1047193042 8:122695851-122695873 CTGTATCTTGATTGGGATGGTGG + Intergenic
1047235314 8:123036500-123036522 CTGTTTCTTGATCTGAATGCTGG + Intronic
1047328991 8:123867870-123867892 CTGCATCTTGATCTGGATGCTGG - Intronic
1047359795 8:124158688-124158710 CTGTACCTTGATTTGAATGCTGG - Intergenic
1047786538 8:128158889-128158911 CTGATTCTTGATCTGGATGTGGG + Intergenic
1048493213 8:134913625-134913647 CTGCATCTTGAAGTGGCTGGGGG + Intergenic
1049806278 8:144542057-144542079 CGCCATCTTGAGCTGGAAGCCGG + Intronic
1050614763 9:7390418-7390440 CAGCATTTGGGTCTGGATGCAGG + Intergenic
1051104764 9:13566792-13566814 CTGTTTCTCGATGTGGATGCTGG + Intergenic
1051228591 9:14929549-14929571 CTATATCTTGATCTGGAGGTTGG - Intergenic
1053091671 9:35283917-35283939 CTGTTTCTTGATCTGTGTGCTGG + Intronic
1053616180 9:39768960-39768982 CTATATGTTGATCTGAATGCGGG + Intergenic
1054237337 9:62573430-62573452 CTATATGTTGATCTGAATGCGGG - Intergenic
1054551472 9:66607941-66607963 CTATATGTTGATCTGAATGCGGG - Intergenic
1054758037 9:68978790-68978812 CTTTATCTTGATCTGGGTGATGG - Intronic
1054786115 9:69211760-69211782 CTGCATCTCCATCTGTGTGCTGG + Intronic
1054833434 9:69651316-69651338 CTAGATCTTGATCTGGGTGGTGG + Intronic
1055326117 9:75131912-75131934 CTAGATCTTGATCTGGGTGTTGG - Intronic
1055693909 9:78862299-78862321 CTGCACCTTGATCTGTATGGTGG - Intergenic
1055748862 9:79481908-79481930 TTACATATTGATCTGCATGCTGG + Intergenic
1056663542 9:88562345-88562367 CTGCATCTCCATCTAGGTGCTGG + Intronic
1057826984 9:98378803-98378825 CTGCTTCTTGATATGGATCCTGG + Intronic
1057942807 9:99299636-99299658 CTCTATCTTGATCTGGGTGGTGG - Intergenic
1057943801 9:99307150-99307172 CTGTTTCTTGATCTGGGTGGTGG + Intergenic
1058051029 9:100406712-100406734 CTTCACCTTGATCTGGATGATGG + Intergenic
1058152706 9:101479829-101479851 CTGCAGCTTGATCTAGAAGGAGG - Intronic
1058325857 9:103696743-103696765 CTGTAACTTAATCTGGGTGCTGG + Intergenic
1058450445 9:105091430-105091452 CTGAACCTTGATCTGGAGCCCGG - Intergenic
1059201072 9:112417201-112417223 CTGTATCTTGATTTGGGTGTTGG - Intronic
1059209216 9:112496467-112496489 CTGTTTCTTGAACTGGTTGCTGG + Intronic
1059391761 9:114003716-114003738 CTGTTTCTTGAGCTGGGTGCTGG + Intronic
1059557317 9:115294385-115294407 CTGCATCCTCACCTGGATCCCGG + Intronic
1059657120 9:116367341-116367363 CTGTATTTTGTTCTGGATGTGGG + Intronic
1060601668 9:124882263-124882285 CTGCATCCTCATCTGGAAGTGGG - Intronic
1062249421 9:135586889-135586911 CAGCCTCTTCATCTGGCTGCTGG + Intergenic
1186541650 X:10407352-10407374 CTCCATCTTGTCCTGAATGCTGG - Intergenic
1188543595 X:31276962-31276984 CTGTTTCTTTATTTGGATGCTGG + Intronic
1188965798 X:36549388-36549410 CTGTTTCTTGATGTGGGTGCTGG - Intergenic
1189263199 X:39692776-39692798 CTGTTTCTTGATCTGGGTGTGGG - Intergenic
1189302484 X:39962124-39962146 TTGCTTCTTGATTTGAATGCTGG - Intergenic
1189327149 X:40119720-40119742 CTGCAGGTTGATCTGGAAGCTGG + Intronic
1189526602 X:41829216-41829238 CTGTTTCTTGATCTGGATGCTGG - Intronic
1189851624 X:45183008-45183030 CAGTATCTTGATATGGATGGTGG + Intronic
1190816181 X:53931725-53931747 CTGTATCTTGATAGGGATGTGGG + Intergenic
1191084734 X:56552535-56552557 CTGTTTCTTCATCTGGCTGCTGG + Intergenic
1192195517 X:69025268-69025290 CCCCATCTTGGTCTGGAAGCTGG + Intergenic
1192254660 X:69445400-69445422 CTGTTTCTTGATCTGGGTGTTGG - Intergenic
1192506760 X:71690442-71690464 CTATATTTTGATCTGGATGGCGG + Intergenic
1192513178 X:71738598-71738620 CTCTATTTTGATCTGGATGGCGG - Intergenic
1192513519 X:71742915-71742937 CTCTATTTTGATCTGGATGGCGG + Intergenic
1192519937 X:71791104-71791126 CTATATTTTGATCTGGATGGCGG - Intergenic
1193259322 X:79386836-79386858 CTGCACATAGATTTGGATGCTGG + Intergenic
1194668371 X:96700467-96700489 CTGCATCTGCATCTGCATCCAGG - Intronic
1195198913 X:102527579-102527601 CTGTGTCTTGATCTGGGGGCTGG - Intergenic
1195588330 X:106592803-106592825 CTAGATCTGGATCTGGATGTTGG - Intergenic
1196490883 X:116264774-116264796 CTACAACTTGATCTGGGTGGTGG + Intergenic
1197025266 X:121740290-121740312 CTGCATCTGGATTTGGAGACAGG + Intergenic
1197053478 X:122089644-122089666 CTGCATCTTGATTGGGGTGTTGG + Intergenic
1198228103 X:134665163-134665185 CTCTATCTTGATCTAGATTCTGG - Intronic
1198503940 X:137282165-137282187 CTGTTTCTTGATCTGGGTGCTGG + Intergenic
1199669245 X:150128374-150128396 ATGTTTCTTGATCTGGATGATGG - Intergenic