ID: 1047337847

View in Genome Browser
Species Human (GRCh38)
Location 8:123953501-123953523
Sequence GTGCCTGTCTCTACAAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047337838_1047337847 6 Left 1047337838 8:123953472-123953494 CCAGAGCTCTTGGCTTCAGAAGG 0: 1
1: 0
2: 2
3: 20
4: 195
Right 1047337847 8:123953501-123953523 GTGCCTGTCTCTACAAGGTGGGG No data
1047337836_1047337847 23 Left 1047337836 8:123953455-123953477 CCAATGGGCAGCAGGGTCCAGAG 0: 1
1: 0
2: 3
3: 32
4: 250
Right 1047337847 8:123953501-123953523 GTGCCTGTCTCTACAAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047337847 Original CRISPR GTGCCTGTCTCTACAAGGTG GGG Intronic
No off target data available for this crispr