ID: 1047340398

View in Genome Browser
Species Human (GRCh38)
Location 8:123975271-123975293
Sequence CCTCGGTGTCAGAAGTTTTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047340398_1047340405 11 Left 1047340398 8:123975271-123975293 CCCTAAAACTTCTGACACCGAGG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1047340405 8:123975305-123975327 AAGTAAGACAGGTCCATCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 112
1047340398_1047340402 0 Left 1047340398 8:123975271-123975293 CCCTAAAACTTCTGACACCGAGG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1047340402 8:123975294-123975316 AGCCAATAGAAAAGTAAGACAGG 0: 1
1: 0
2: 1
3: 22
4: 289
1047340398_1047340404 10 Left 1047340398 8:123975271-123975293 CCCTAAAACTTCTGACACCGAGG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1047340404 8:123975304-123975326 AAAGTAAGACAGGTCCATCCTGG 0: 1
1: 0
2: 1
3: 15
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047340398 Original CRISPR CCTCGGTGTCAGAAGTTTTA GGG (reversed) Exonic
903048368 1:20582182-20582204 CCTGGCTATCAAAAGTTTTAAGG - Intergenic
906620551 1:47274615-47274637 CCTCTTTCTCAGAACTTTTAGGG + Intronic
906621719 1:47286406-47286428 CCTCTTTCTCAGAACTTTTAGGG - Intronic
907007777 1:50932831-50932853 CCTCGATTTCAGAAGATGTACGG - Intronic
909104530 1:71392043-71392065 CCTAGGTTTCAGAAGATGTATGG + Intergenic
912073163 1:105839462-105839484 CCTAGATATCAGAAGTTGTATGG + Intergenic
913039069 1:115005452-115005474 CCTTGGAGTCAGATGTTTGAGGG + Intergenic
918119882 1:181529290-181529312 CCTAGATTTCAGAAGTTGTATGG + Intronic
919036529 1:192318014-192318036 ATTTGGTGTCATAAGTTTTAGGG - Intronic
920981640 1:210841939-210841961 CCTGCTTGTCAGAAGTTTTCAGG - Intronic
1068358283 10:55940952-55940974 TCTAGGTGGCAGAAGATTTATGG + Intergenic
1068552938 10:58426446-58426468 CCTAGATTTCAGAAGATTTATGG - Intergenic
1070376012 10:75831738-75831760 CCTAGATTTCAGAAGATTTATGG - Intronic
1071691371 10:87823463-87823485 CCTCATTAGCAGAAGTTTTAAGG + Intronic
1073153440 10:101327867-101327889 CCTAGATTTCAGAAGATTTATGG + Intergenic
1073817559 10:107224322-107224344 CCTAGGTTTCAGAGGATTTATGG - Intergenic
1073922117 10:108470968-108470990 CCTAGGTTTCAGAAGATGTATGG - Intergenic
1076464826 10:130671868-130671890 CCTAGATTTCAGAAGTTGTATGG - Intergenic
1076752456 10:132550356-132550378 CCTGGGTGTCAGTGGTTTTTGGG + Intronic
1077377872 11:2213970-2213992 GCTCGGTGTTATAAGTTCTATGG + Intergenic
1079147597 11:17867739-17867761 CCTAGGTTTCAGAAGATGTATGG - Intronic
1082766180 11:57169696-57169718 CCTAGATTTCAGAAGTTGTATGG - Intergenic
1088188934 11:107205612-107205634 CCTAGATTTCAGAAGATTTATGG - Intergenic
1090797034 11:130144060-130144082 CCTTGGTGACAGGACTTTTATGG - Exonic
1092326278 12:7534688-7534710 CCTAGATTTCAGAAGATTTATGG + Intergenic
1093207068 12:16263875-16263897 CCTAGGTTTCAGAAGATGTATGG + Intronic
1098926883 12:76360674-76360696 CCTCGATTTCAGAAGATGTATGG - Intronic
1100393872 12:94167771-94167793 ACTCGGTTTAAGAAGATTTAGGG - Intronic
1100486649 12:95035387-95035409 CCTCTGATTCTGAAGTTTTAAGG + Intronic
1102910091 12:116707124-116707146 CCTGAGTGTCAGAAGTGCTAAGG - Intergenic
1103017420 12:117506528-117506550 CCTGGGTGTCAGAAGAGTTTTGG + Intronic
1104666865 12:130653706-130653728 CCTAGATTTCAGAAGATTTATGG - Intronic
1107319355 13:39168957-39168979 CCTCGGTAGCTGAATTTTTAGGG - Intergenic
1108242880 13:48485530-48485552 GTTTGGCGTCAGAAGTTTTAAGG + Intergenic
1111313254 13:86517283-86517305 CCTAGATTTCAGAAGTTGTATGG - Intergenic
1114938221 14:27572276-27572298 TCTCAGTGTCATAAATTTTAAGG - Intergenic
1121130233 14:91439260-91439282 CCTAGGTTTCAGAGGTTGTATGG + Intergenic
1122590625 14:102847646-102847668 CCTGTGTGTCATATGTTTTAAGG - Intronic
1127605676 15:60585408-60585430 CCTTGGTTTCTGAAGATTTATGG - Intronic
1128006792 15:64250058-64250080 TCTAGGTTTCATAAGTTTTAGGG - Intronic
1128859094 15:71050406-71050428 CCTGTGTCTCAGAAGTATTAGGG + Intronic
1141236825 16:82226369-82226391 CATCTGTGTCAGTATTTTTAAGG + Intergenic
1153136916 18:1927572-1927594 CCTAGATTTCAGAAGATTTATGG + Intergenic
1155411463 18:25549926-25549948 CCTCAGTGCCAGGAGTTTTTCGG - Intergenic
1163587742 19:18173235-18173257 CGTCGGGGTCAGGAGTTTGAGGG + Intronic
1165373608 19:35425941-35425963 CCTCCGAGTCAGAAGTTCCAAGG - Intergenic
931777324 2:65551798-65551820 CCTTGGTGTCAAAATATTTAGGG + Intergenic
933120120 2:78526035-78526057 CTTCAGTGTCAGAAGTGTTATGG - Intergenic
933447898 2:82404834-82404856 TCAAGGTGCCAGAAGTTTTAAGG + Intergenic
936959079 2:118054769-118054791 CATATGTGTTAGAAGTTTTAAGG + Intergenic
938100402 2:128494073-128494095 CTGCGGTGTCAGAAGATTAAGGG - Intergenic
939050232 2:137298807-137298829 CCTAGATTTCAGAAGTTGTATGG + Intronic
943124781 2:183782781-183782803 CCTAGGTTTCAGAAGATGTATGG + Intergenic
944626334 2:201573059-201573081 CCTGGGTGTCACCAGTTTTGTGG - Intronic
947296427 2:228635684-228635706 CCTAGATGTCAGAAGATGTATGG - Intergenic
947947066 2:234114173-234114195 ACTTGGAGTCAGATGTTTTAAGG + Intergenic
948467939 2:238161103-238161125 CCCCAGTGTCAGAAGTTCTAAGG - Intronic
1172540478 20:35711534-35711556 CTTCGCTGTCAGAAATTCTAGGG + Intronic
1173407805 20:42781751-42781773 CTTCCGTGTAAGCAGTTTTAGGG - Intronic
1175585654 20:60137472-60137494 GCTCTGTGTGAGAAGTTCTAAGG + Intergenic
1177317453 21:19479398-19479420 CCTAGATTTCAGAAGTTGTATGG - Intergenic
1179519868 21:41935563-41935585 CCTCAGTGTCAGAACTTTTCTGG - Intronic
1183443717 22:37838854-37838876 CCTCAGGGTCAGAAATTTTAGGG + Intronic
1183550406 22:38479646-38479668 TCTCACTGTCAAAAGTTTTACGG - Exonic
950464707 3:13146484-13146506 CCTTGGTGGCTGAGGTTTTATGG - Intergenic
952983490 3:38757113-38757135 CCGGGTTGTCAGAAGTTTTAAGG + Exonic
954597150 3:51835887-51835909 CTTGGGTGTCAGGAGTTTTTGGG + Intergenic
957444031 3:80291833-80291855 CCTAGATTTCAGAGGTTTTATGG - Intergenic
958911121 3:99995659-99995681 CCTAGATGTCAGAAGATGTATGG - Intronic
959893656 3:111583577-111583599 CCTAGATTTCAGAAGATTTATGG - Intronic
960842943 3:121978696-121978718 CCTAGGTTTCAGAAGATGTATGG + Intergenic
961065536 3:123872298-123872320 GCTGGGTGTCAGAAGTGTTCTGG - Intronic
962181494 3:133210470-133210492 CCTGGGAGTCAGAATTTCTAAGG + Intronic
963473907 3:145779463-145779485 CCTATGGGTCAGAAGTTTCAGGG - Intergenic
963927031 3:150961371-150961393 CCTCAGGATCAGTAGTTTTAAGG + Intronic
965629581 3:170718148-170718170 CCTCGGTGTCTGAGGTTTGGTGG - Intronic
965795316 3:172433063-172433085 CCTAGATTTCAGAAGTTGTATGG - Intergenic
969920720 4:10537059-10537081 CCTGGGCATCAGAATTTTTAAGG - Intronic
970568726 4:17358278-17358300 TCAGGGGGTCAGAAGTTTTATGG - Intergenic
974996413 4:69165123-69165145 CCTTTGCGTCAGAATTTTTAAGG + Intronic
975009396 4:69330059-69330081 CCTTTGTGTCAGAATTTTTAAGG + Intronic
975013582 4:69383616-69383638 CCTAGATTTCAGAAGATTTATGG + Intronic
976772437 4:88668095-88668117 CCTCGATATCAGTGGTTTTATGG + Intronic
978921022 4:114183276-114183298 CCTAGATTTCAGAAGTTGTATGG + Intergenic
979500484 4:121434430-121434452 CCTGGGTTTCAGAAGATGTATGG - Intergenic
979573208 4:122254131-122254153 CCTCTGTGTTAGTGGTTTTAAGG + Intronic
982301213 4:153881117-153881139 CCTAGGTTTCAGAAGATGTATGG + Intergenic
985566327 5:620124-620146 CCTCGTTGGCAGAAGTGTTTCGG + Exonic
987373138 5:17211380-17211402 CTACTGTGTCAGTAGTTTTAAGG - Intronic
987894337 5:23925576-23925598 CCTAGGTATCAGAAGATGTATGG - Intergenic
988378993 5:30477114-30477136 CCTAGATGTCAGAAGATGTATGG - Intergenic
990562467 5:56996734-56996756 CCTCGGAGGCAGAGGTTTCAGGG + Intergenic
991567900 5:68023746-68023768 CCTTGGAGGCAGAAGTTTCAGGG + Intergenic
997081715 5:130747051-130747073 CCTAGATGTCAGAAGGTGTATGG + Intergenic
1000449985 5:161373606-161373628 CCTAAGTGTCAGAAGTATTGAGG + Intronic
1007185919 6:39972280-39972302 CCTAGATTTCAGAAGTTGTATGG + Intergenic
1010636046 6:78260402-78260424 CCTAGGTTTCAGAAGATGTATGG - Intergenic
1011150130 6:84262964-84262986 ACATGGTGTAAGAAGTTTTAAGG + Intergenic
1011792723 6:90915640-90915662 CCTCGATTTCAGAGGTTGTATGG + Intergenic
1014449374 6:121565552-121565574 CCTGGATTTCAGAAGTTGTATGG + Intergenic
1016380591 6:143474381-143474403 CCTCGGAGGCAGAGGTTTCAGGG + Intronic
1021226867 7:18037908-18037930 CCTTGGTTACAGAAGTTTTGGGG - Intergenic
1021332115 7:19351102-19351124 CCTCTGTTTCAGAAGCTCTAAGG - Intergenic
1030784753 7:113645692-113645714 CCTAGATTTCAGAAGTTGTATGG - Intergenic
1031145734 7:117995148-117995170 CCTAGGTTTCAGAAGATGTATGG + Intergenic
1033104958 7:138512471-138512493 CCTGGATTTCAGAAGATTTATGG - Intronic
1036462290 8:8963834-8963856 CCTTGGTGTCTGAAGTATTAAGG + Intergenic
1037117830 8:15247326-15247348 CCTAGATTTCAGAAGTTGTATGG + Intergenic
1037514610 8:19618279-19618301 CCTCTGTGTCATAATTTTCAGGG - Intronic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1041479782 8:58307213-58307235 CCTAGATTTCAGAAGTTGTATGG - Intergenic
1043290911 8:78599390-78599412 CTTCGCTGTTAGAATTTTTAAGG + Intronic
1044533611 8:93335878-93335900 TCCCTGTGTCTGAAGTTTTAAGG + Intergenic
1047340398 8:123975271-123975293 CCTCGGTGTCAGAAGTTTTAGGG - Exonic
1052210181 9:25894182-25894204 CCTAGGTTTCAGAAGATGTATGG - Intergenic
1054995855 9:71388421-71388443 GCTCCGTCTCAGAAGTTTTGTGG - Intronic
1057983105 9:99681893-99681915 CCTAGGTTTCAGAAGATGTATGG - Intergenic
1060348789 9:122839295-122839317 CCTAGGTTTCAGAGGATTTATGG - Intergenic
1186280764 X:7990201-7990223 CCTAGGGGTCTGATGTTTTACGG - Intergenic
1186852160 X:13591315-13591337 GCTGGGTCTCACAAGTTTTATGG - Intronic
1193759173 X:85443222-85443244 CCTAGATTTCAGAAGTTGTATGG - Intergenic
1194264532 X:91738547-91738569 CCTAGATTTCAGAAGATTTATGG + Intergenic
1194558941 X:95396778-95396800 CCTAGATTTCAGAAGATTTATGG + Intergenic
1197567161 X:128101641-128101663 CCTAGATTTCAGAAGTTGTATGG - Intergenic
1199868783 X:151877722-151877744 CCTAGATGTCAGAAGATGTATGG - Intergenic