ID: 1047343657

View in Genome Browser
Species Human (GRCh38)
Location 8:124006555-124006577
Sequence CCAAGGTGACATTTTAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047343657 Original CRISPR CCAAGGTGACATTTTAATGG GGG (reversed) Intronic
900978873 1:6035056-6035078 CCAAGGTCACCTTCTCATGGAGG - Intronic
902077285 1:13797718-13797740 CCCAGGTGATTTTTTAATGTAGG - Intronic
902716840 1:18278855-18278877 CCATGTTCACATTTTAATTGTGG + Intronic
902963373 1:19980168-19980190 CCAGGGAGAGAGTTTAATGGGGG + Intronic
905016731 1:34782981-34783003 CCAAGTTGACATTCTAGAGGGGG + Intronic
907795541 1:57712816-57712838 CCAAGATGAAATTTTAATTCAGG + Intronic
908771194 1:67597993-67598015 GGAAGGTGACATTTGAATGCAGG + Intergenic
909179973 1:72411190-72411212 CCACAGTGCCATTTTAGTGGAGG + Intergenic
909201278 1:72692972-72692994 TCAAGGTCATATTTTAAGGGAGG - Intergenic
909791877 1:79689773-79689795 CCAAGTAGACATTTTATTGAAGG - Intergenic
909843907 1:80365900-80365922 CTAAATTGACATTTAAATGGTGG - Intergenic
910264726 1:85326332-85326354 CCAAGATTACAGTTTAGTGGAGG + Intronic
910571619 1:88711347-88711369 CAAAGGTGGTATATTAATGGCGG - Intronic
912729792 1:112092006-112092028 GCAAGGTGATATTTCAATTGGGG + Intergenic
913374623 1:118136955-118136977 CAAAGCAGACATTTTACTGGGGG + Intronic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
913974294 1:143442183-143442205 CCAAGTTGACATATGAATGAAGG + Intergenic
914068683 1:144267797-144267819 CCAAGTTGACATATGAATGAAGG + Intergenic
914110472 1:144698557-144698579 CCAAGTTGACATATGAATGAAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
916469591 1:165109721-165109743 CCAAGATTAAATTTTTATGGTGG + Intergenic
917267505 1:173236928-173236950 TCAAGGTGAGATTTTGGTGGGGG - Intergenic
919095770 1:193033805-193033827 CAAATGTGAAATTTTAATAGGGG + Intronic
919407563 1:197203623-197203645 CCTACTTGACATTTTAATAGAGG + Intergenic
1063745233 10:8871747-8871769 CGAAAGTGACATTGCAATGGGGG + Intergenic
1063940711 10:11125752-11125774 ACAAGTAGACACTTTAATGGGGG - Intronic
1063998030 10:11639732-11639754 CCCAGGTGACATTTCAGGGGAGG - Intergenic
1064505961 10:16030141-16030163 CTTACATGACATTTTAATGGAGG + Intergenic
1065742312 10:28808129-28808151 TCAAGTTTACATTTTAATGGAGG - Intergenic
1066465600 10:35647371-35647393 CCAATGTGACAATTCAGTGGTGG - Intergenic
1069198635 10:65585876-65585898 CCTAGATGAGATTTTAATGTTGG + Intergenic
1069198708 10:65586793-65586815 GCAAAGTCACATCTTAATGGCGG - Intergenic
1069236061 10:66075325-66075347 CCAAAGTGGAATTTGAATGGTGG - Intronic
1070608052 10:77913377-77913399 CAAAGATGTCATTTTATTGGTGG - Intronic
1075355025 10:121764111-121764133 CCAATGTGAGATGTTAATGATGG + Intronic
1078202433 11:9195556-9195578 CCAAGCTGTGATTTAAATGGTGG - Intronic
1078703905 11:13719118-13719140 TCAAGGTGACATTGTATTGTAGG + Intronic
1079317775 11:19423964-19423986 CAAAGATGACATGTTAATGAAGG + Intronic
1081835464 11:46149812-46149834 CCCAGATGACTCTTTAATGGTGG + Intergenic
1082674988 11:56087228-56087250 ACAATGAGACATTTTACTGGTGG + Intergenic
1084995339 11:72971730-72971752 CCAAGGTGACATTTGGATTTTGG + Intronic
1089592701 11:119554859-119554881 CACAGGAGACATTTTGATGGTGG + Intergenic
1089923927 11:122237706-122237728 TCAAGATGAGATTTGAATGGTGG - Intergenic
1091179140 11:133587928-133587950 CCAAAGTGACACAATAATGGAGG - Intergenic
1091306219 11:134537891-134537913 CAAATCTGACATTTTATTGGAGG + Intergenic
1093436357 12:19139286-19139308 CCAGGTGGACATATTAATGGTGG + Intronic
1097316700 12:58179277-58179299 CAAAAGTGAAATTTTAATGAGGG + Intergenic
1100789711 12:98117329-98117351 CTAAGGGGACATGTTCATGGAGG + Intergenic
1100922375 12:99502610-99502632 CCAAGGTTACATGTTAATGAGGG - Intronic
1101240772 12:102836897-102836919 TAAAGCTGACATTTTATTGGTGG + Exonic
1102402609 12:112643128-112643150 CCAAGGTGAGATTTGAATCTAGG + Intronic
1102620459 12:114190610-114190632 AGAAGGTGACATTTAAATAGAGG - Intergenic
1104275839 12:127326981-127327003 ACAAGATTACAGTTTAATGGGGG - Intergenic
1104278546 12:127352885-127352907 CAAAGCTGACATTCTAGTGGAGG - Intergenic
1106333669 13:28763441-28763463 CAAAGTAGACATTTTAATCGGGG - Intergenic
1106690812 13:32113965-32113987 TCAGGGTGACTTTTTAATGGGGG + Intronic
1108838125 13:54576934-54576956 CCAATGAGATATTTTAAAGGGGG + Intergenic
1109585239 13:64392910-64392932 CCAAGGTGAGAAGTTGATGGGGG - Intergenic
1111271331 13:85891449-85891471 TCAAGATGAGATTTGAATGGGGG - Intergenic
1111833831 13:93362432-93362454 CCAAGGTGAGAATGTAAGGGTGG + Intronic
1113321679 13:109238579-109238601 CCCAGGTCACATGTTCATGGTGG + Intergenic
1113327545 13:109296402-109296424 TCAAGATGACATTTTGACGGCGG + Intergenic
1113357239 13:109592629-109592651 CAAAGGGTACATTTTAATGATGG + Intergenic
1114051856 14:18926553-18926575 CCAAGGAGTAATTTTAATGAAGG + Intergenic
1114110702 14:19475368-19475390 CCAAGGAGTAATTTTAATGAAGG - Intergenic
1114459074 14:22875515-22875537 CCAAGGTGACATTGCAAGGCAGG - Exonic
1115088013 14:29540169-29540191 TCAAGATGTCTTTTTAATGGTGG + Intergenic
1115300977 14:31885017-31885039 TCAAGGTGAGATTTTGATGGGGG - Intergenic
1117068313 14:52032713-52032735 CCATGGTGAAATTTTGATGCTGG - Intronic
1117841143 14:59861575-59861597 CCAGGTTGCCATTTTAATGTGGG - Intronic
1121567265 14:94919355-94919377 CCAAGGAGACTGTTTGATGGGGG + Intergenic
1122643514 14:103176495-103176517 CGAAAGTGAGATTTTAATGACGG - Intergenic
1128807919 15:70547092-70547114 TCAAGGTGAGATTTGAGTGGAGG - Intergenic
1132672798 16:1108597-1108619 CCAACGGAACATTTTAATGACGG + Intergenic
1133635412 16:7660572-7660594 CCTAGGTTATATTCTAATGGAGG - Intronic
1134039202 16:11054953-11054975 CCAAGTAGACTTTTTAAAGGAGG + Intronic
1134676514 16:16094395-16094417 CCATTCTGACATTATAATGGTGG - Intronic
1137495697 16:48967538-48967560 CCAAGGTTATATTTTAGTGAGGG + Intergenic
1138546941 16:57725361-57725383 TCAAGGTGAGATTTTGGTGGGGG + Intronic
1138605024 16:58083199-58083221 AAAAGGTGACATTTGAATTGGGG - Intergenic
1139169866 16:64616890-64616912 AGAAGGTGACATTTTAATTTGGG + Intergenic
1141060999 16:80869756-80869778 CCCAGTCAACATTTTAATGGTGG + Intergenic
1141742949 16:85906419-85906441 CTAAGTTGACCTTTTAATGCTGG + Intronic
1142093646 16:88227889-88227911 CCAAGGTCCCATAATAATGGAGG - Intergenic
1142482326 17:226694-226716 TTACGGTGACATTTCAATGGAGG - Intronic
1143234679 17:5389100-5389122 CCAAAGTGACCTTTTCAAGGTGG - Intronic
1150337501 17:64341461-64341483 CCGAGGTGACTTTTTAAGGGTGG + Intronic
1150908009 17:69359270-69359292 ACAATGTCACATTTTAATTGAGG - Intergenic
1153392430 18:4577916-4577938 CCAGGGTGACATGGAAATGGTGG + Intergenic
1158452784 18:57581664-57581686 GCAAGGTGTCATTTTACAGGTGG - Intronic
1160255486 18:77244818-77244840 CTAAGGGGACATTTTAACTGGGG + Intergenic
1161307584 19:3576517-3576539 ACAAGGTGGCAATTTACTGGTGG - Intronic
1163472022 19:17503018-17503040 GCAAAGGGACTTTTTAATGGTGG + Intronic
1164813217 19:31174751-31174773 GCAAGGTGACATTGGTATGGAGG + Intergenic
930536445 2:52650945-52650967 CCAAGTTGGCATTGTAATTGTGG + Intergenic
931254808 2:60561121-60561143 CCAAGGTCACATTTTGGTGGAGG - Intergenic
932413414 2:71560256-71560278 CCAAAGGGAGATTTTCATGGAGG - Intronic
932920841 2:75913653-75913675 TGAAGGTGATTTTTTAATGGTGG + Intergenic
934178998 2:89603158-89603180 CCAAGTTGACATATGAATGAAGG + Intergenic
935036440 2:99379889-99379911 CAAAGGTGACACTTAAAGGGTGG - Intronic
935897662 2:107755134-107755156 GGAAGGTGAGATTTTAATGAAGG - Intergenic
940337222 2:152542063-152542085 CCAAGGTGATATCTGAATGTAGG - Intronic
945265987 2:207891925-207891947 CTCAGGTGACATTTTATTTGGGG + Intronic
946131262 2:217608738-217608760 TCAAGGTCACATTTGCATGGTGG + Intronic
947006193 2:225514010-225514032 TCAAGGGGACATTTTAATTCAGG + Intronic
1168745062 20:232360-232382 GAAAGGTGACCTTTGAATGGAGG - Intergenic
1172757259 20:37294657-37294679 CAAAGGTGACATTTCAACAGAGG - Intronic
1172981768 20:38948513-38948535 CCAATGTGACACTTCAAAGGTGG - Intronic
1173970509 20:47148708-47148730 CCCAGGTGACATTTCAGAGGAGG - Intronic
1174368718 20:50071970-50071992 TGAAGCTGACATTTTAGTGGGGG + Intergenic
1177347907 21:19897666-19897688 ATATGGTGACATTTTAATGGAGG + Intergenic
1177445020 21:21183458-21183480 CCATGGGGACATATTAGTGGGGG + Intronic
1179638514 21:42731409-42731431 GCAAGGTGACATTCTAAGGAAGG - Intronic
1180470330 22:15648932-15648954 CCAAGGAGTAATTTTAATGAAGG + Intergenic
1182084992 22:27555379-27555401 CAAAGCTGACATTTTAAATGGGG - Intergenic
1182113567 22:27742023-27742045 CCTAGGAGACATTTTCATGGGGG - Intergenic
1183046375 22:35223795-35223817 CCTGGGTTACATTTTGATGGAGG - Intergenic
949514319 3:4793654-4793676 CCCATGTGACAATTGAATGGGGG - Intronic
955643191 3:61109074-61109096 CCAAGTGAACATTTTATTGGAGG + Intronic
956284202 3:67591412-67591434 TCAAGGTGAGATTTGGATGGGGG - Intronic
959438864 3:106352081-106352103 TCAAGGTGAGATTTGAGTGGGGG - Intergenic
959561215 3:107784139-107784161 TCAAGATTACATTATAATGGGGG + Intronic
960280159 3:115772290-115772312 CGAAGCTTACATTTTCATGGAGG + Intergenic
960928666 3:122821781-122821803 CCAATGTGACATTTTAAAAAAGG - Intronic
963458050 3:145572516-145572538 TCAAGCTTACATTCTAATGGGGG + Intergenic
963535931 3:146528633-146528655 CCAGGTGGACAGTTTAATGGAGG + Exonic
965915464 3:173841181-173841203 CAAATGTGACAATTTCATGGTGG + Intronic
966193479 3:177291735-177291757 CCGACATGACATTTTAATGACGG + Intergenic
967597787 3:191348151-191348173 CATAGGTGACATTTGAATGGGGG + Intronic
967854066 3:194103363-194103385 CCCAGGTGACATTATACTGCTGG + Intergenic
968929932 4:3573456-3573478 GCAAGGAGACTTTTGAATGGAGG - Intergenic
969830284 4:9790467-9790489 CCAAGTTGACATATGAATGAGGG - Intronic
970918668 4:21367080-21367102 TCAAGGTGCCATTTTAAAAGTGG + Intronic
971983630 4:33790401-33790423 CAAAGGTGACATTTAAATTCTGG - Intergenic
974887683 4:67840401-67840423 TCAAGATGAGATTTTAGTGGGGG + Intronic
976808413 4:89073836-89073858 TCAAGGTGACTTTGTAATTGAGG + Intronic
978193125 4:105939146-105939168 CAAAGCTGACATGCTAATGGGGG + Intronic
978262712 4:106780453-106780475 TCAAGGTGAGATTTCAGTGGGGG + Intergenic
979406063 4:120311623-120311645 TCAAGATGACATTTGGATGGTGG + Intergenic
979490534 4:121321767-121321789 CAAAGGTGATTTTTTAATGAAGG - Intergenic
979544905 4:121929248-121929270 GCAAGGTGACATTTTATAGCAGG - Intronic
980770275 4:137363234-137363256 CCAGGGTGACATAGTCATGGAGG + Intergenic
982104852 4:152002956-152002978 CCCAGGTGAAATTTTACTGGAGG - Intergenic
984648649 4:182245933-182245955 CCGATGTAACATTTTATTGGCGG + Intronic
986814988 5:11399064-11399086 CGAAGGTCACATTTTAATGGTGG + Intronic
987008816 5:13739200-13739222 TCAAGGTGAGATTTGAGTGGGGG - Intronic
987235329 5:15936489-15936511 CAAGGGTGACAGTTTAATGGAGG - Exonic
989212279 5:38867752-38867774 CCTAGGTTAAATTTTAATGAGGG + Intronic
989731749 5:44657129-44657151 TCAAGGTGAGATTTGGATGGGGG - Intergenic
992632406 5:78694710-78694732 CCAAGGTCACATTTTTCTTGGGG + Intronic
992635386 5:78721383-78721405 CATATGTGACATTTTAAAGGGGG - Intronic
994546480 5:101173137-101173159 CCAAGATGAAATTTTATTGGGGG - Intergenic
999286167 5:150395505-150395527 ACAAGGAGACATTTTAGAGGGGG + Intronic
999700770 5:154225703-154225725 CAAAGTTCACATTTTAATGGAGG + Intronic
999709840 5:154308349-154308371 CCAAGGCCACATTATTATGGGGG - Intronic
1006574320 6:35033075-35033097 CCAATGTGACATTATCAAGGGGG - Intronic
1008266522 6:49434466-49434488 ACAAGGTCACATTTTACTGATGG + Intronic
1009411337 6:63368520-63368542 AAAAGGTGACCTTTTAATAGAGG - Intergenic
1011536492 6:88381509-88381531 CCAAGGTCATATTTTCAGGGAGG - Intergenic
1013011271 6:106122663-106122685 CCAAGGTGGCAGTTTGATGAGGG - Intergenic
1013364732 6:109428261-109428283 CCAGGGTGGCATTTTAATGTAGG - Intronic
1013699227 6:112743442-112743464 CTAAGCTGACACTTTAATTGTGG + Intergenic
1014721789 6:124925923-124925945 CCAAAGTGACATATTATGGGTGG - Intergenic
1016460264 6:144274293-144274315 TCAAGTTGAGATTTGAATGGGGG + Intergenic
1018207470 6:161448933-161448955 CCAAGGTCACATTAAAAAGGTGG + Intronic
1019519225 7:1453148-1453170 CCAATGTGTCATTTTCTTGGGGG - Intronic
1020731714 7:11888814-11888836 ACAAGATGAGATTTGAATGGAGG - Intergenic
1020770301 7:12383665-12383687 CCAAGATGACAATTTATTGAAGG + Intronic
1020876670 7:13704111-13704133 CCAGAGTGACATTTTAATGTTGG - Intergenic
1020937578 7:14486502-14486524 CCCAGGTGACATTTTCACCGAGG + Intronic
1021169512 7:17381826-17381848 CAGAGGTGACATTTGAATTGAGG - Intergenic
1023450180 7:40275942-40275964 GCAAGGAGACATTTTACTGTGGG + Intronic
1026152438 7:67799664-67799686 CGGAGGTGAGATTTTAAGGGTGG - Intergenic
1030866564 7:114707540-114707562 ACATGGAGACATTTTAATGAAGG + Intergenic
1031139979 7:117931902-117931924 CCAAGGTGACTTTTGAAAAGAGG + Intergenic
1031162013 7:118179913-118179935 CCTAGGTGGCATAGTAATGGTGG - Intergenic
1032512515 7:132482997-132483019 CCATGGTGACTTTTTAAAAGAGG - Intronic
1036848681 8:12186690-12186712 CCAAGGTCACCTGTTAATGAAGG + Exonic
1036870042 8:12428971-12428993 CCAAGGTCACCTGTTAATGAAGG + Exonic
1036943123 8:13070240-13070262 CCCAGGTGACATCTTAATTTTGG - Intergenic
1038523106 8:28250169-28250191 GCAAGCTGACATTTTAGTTGGGG - Intergenic
1038719392 8:30020115-30020137 TGAAGGTGATATTTTCATGGTGG + Intergenic
1039455336 8:37702240-37702262 CAAAGTTGCCATCTTAATGGAGG + Intergenic
1041783596 8:61606514-61606536 TCAAGTTGATATTTTAATTGTGG + Intronic
1042387182 8:68190268-68190290 AGAATGTGACATTTTAATGTCGG - Intronic
1042652678 8:71060442-71060464 CCAAGGGGACAATTTCAGGGTGG - Intergenic
1043922173 8:85995921-85995943 CGAAACTTACATTTTAATGGAGG + Intronic
1044003314 8:86912043-86912065 AAAATGTGACATTTTTATGGGGG + Intronic
1045684507 8:104698524-104698546 CAAAGGTAATATTTTAATAGGGG + Intronic
1047343657 8:124006555-124006577 CCAAGGTGACATTTTAATGGGGG - Intronic
1048937529 8:139369408-139369430 CACAGGTGACATTTTAATTATGG + Intergenic
1051843761 9:21428593-21428615 CAAAGGTTACATTGTAATGGGGG - Intronic
1054460348 9:65459015-65459037 GCAAGGAGACTTTTGAATGGAGG + Intergenic
1058892786 9:109375190-109375212 CCAAGGTGAGATTTGGGTGGGGG - Intergenic
1061290333 9:129647128-129647150 CCATGCTGAGATGTTAATGGTGG + Intergenic
1062095504 9:134701195-134701217 TCAAGGTGACATTTTTCTTGTGG - Exonic
1186018640 X:5228090-5228112 CAAAGGAGTAATTTTAATGGAGG + Intergenic
1186163923 X:6806627-6806649 CCTAGGTGAGATTTTTATGATGG + Intergenic
1186636386 X:11409492-11409514 CCAAGGTGACACTGTGAAGGTGG + Intronic
1187293547 X:17977749-17977771 CCAAGCTGACATTTCCATGCAGG - Intergenic
1187615932 X:20992933-20992955 TCAAGGTGAGATTTTGGTGGGGG + Intergenic
1189260130 X:39672597-39672619 CCACAGTGACATTTTGATGAAGG - Intergenic
1190148128 X:47917227-47917249 CCAAAGTGACTTTTAAATTGTGG - Exonic
1194439995 X:93920555-93920577 ACAGGGTGACATTTTACTGGTGG + Intergenic
1197067503 X:122251129-122251151 GAAAGGTGACATTTTTATGAAGG - Intergenic