ID: 1047343791

View in Genome Browser
Species Human (GRCh38)
Location 8:124007695-124007717
Sequence GTTACCTGCTTGGCTAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047343791_1047343796 17 Left 1047343791 8:124007695-124007717 CCATTTTTAGCCAAGCAGGTAAC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1047343796 8:124007735-124007757 TGGCAACAAAAAATATCAGATGG No data
1047343791_1047343797 21 Left 1047343791 8:124007695-124007717 CCATTTTTAGCCAAGCAGGTAAC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1047343797 8:124007739-124007761 AACAAAAAATATCAGATGGATGG No data
1047343791_1047343798 25 Left 1047343791 8:124007695-124007717 CCATTTTTAGCCAAGCAGGTAAC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1047343798 8:124007743-124007765 AAAAATATCAGATGGATGGATGG No data
1047343791_1047343793 -3 Left 1047343791 8:124007695-124007717 CCATTTTTAGCCAAGCAGGTAAC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1047343793 8:124007715-124007737 AACCTACTAGCATTAATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047343791 Original CRISPR GTTACCTGCTTGGCTAAAAA TGG (reversed) Intronic
902747529 1:18483388-18483410 GTTGCCTGTTTGCCTAGAAATGG - Exonic
903177057 1:21587533-21587555 GTCACCTGGTTGGGGAAAAATGG + Intergenic
903320601 1:22540943-22540965 TTTCCTTGCTTGGCTAACAAAGG - Intergenic
906885803 1:49647219-49647241 CTTACCTGCTAGGCTGGAAATGG - Intronic
908677890 1:66626640-66626662 GTTACCTGCTTGGCTGCAAAAGG - Intronic
909366232 1:74825909-74825931 GTTATCTGTTTAGCTAAAACTGG + Intergenic
911975526 1:104489529-104489551 GGTACCAGCTTGGCCAAAATGGG + Intergenic
918011908 1:180594758-180594780 CCTTCCTGCTTGGCTAAAAGAGG - Intergenic
919256533 1:195132122-195132144 GTTATTTTGTTGGCTAAAAAGGG + Intergenic
919534730 1:198773588-198773610 GTTACCTGCAGGGATAAAGAAGG + Intergenic
922165487 1:223112414-223112436 ATTAGCTGCGAGGCTAAAAAAGG + Exonic
922388544 1:225113971-225113993 GGTACCAGCTTGGCTACAATGGG - Intronic
922629155 1:227086777-227086799 GTTACCTGGAAGGCTAAAACGGG - Intronic
922694879 1:227724917-227724939 TTTACCTTCTTGGGGAAAAAAGG - Intergenic
1071008767 10:80913370-80913392 GTTACATGCTTGGAAAAACATGG - Intergenic
1073124565 10:101141399-101141421 GTTCCCTGCGTGGCTCAAAAGGG + Intergenic
1075276794 10:121101132-121101154 TTTACATGTTTGGCTAATAAAGG + Intergenic
1076098212 10:127750911-127750933 ATTCCCTGCTTGGCCAACAAAGG - Intergenic
1076493160 10:130877657-130877679 GTCACCTGCTTGGCTATTGATGG - Intergenic
1078187472 11:9064754-9064776 GTTACCTGCTTGGTAACCAATGG + Intronic
1079298921 11:19260078-19260100 GTTCCATGCTTTTCTAAAAATGG + Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085969570 11:81570967-81570989 GTCACCTGCTCAGCTAAAGATGG + Intergenic
1097837048 12:64283596-64283618 GTTACATGCCTTGCTTAAAAAGG + Intronic
1104138039 12:125959092-125959114 GTCACATGCCAGGCTAAAAAAGG + Intergenic
1104425172 12:128670724-128670746 GTTACCTGCTTAGCTACAGTAGG - Intronic
1105836912 13:24220270-24220292 GTTTCCTTCTTGGTTATAAAAGG + Intronic
1107131183 13:36897706-36897728 CTTACTTGATTGGGTAAAAAAGG + Intronic
1107658785 13:42617884-42617906 GTAAGCTGCTTGGGTAAAGATGG + Intergenic
1108249171 13:48547921-48547943 CTTAAATGCCTGGCTAAAAAAGG - Intergenic
1111147874 13:84208299-84208321 GTAACCTGTTTAGTTAAAAACGG + Intergenic
1112938104 13:104825948-104825970 GTTACCTGCATGGCCAGAGAAGG + Intergenic
1114775565 14:25477062-25477084 ATTACCTCCTTGGCAAAATAAGG + Intergenic
1114775718 14:25478839-25478861 ATTACCTCCTTGGCAAAACAAGG + Intergenic
1117638071 14:57768364-57768386 CTTACCTCTTTGACTAAAAAGGG - Intronic
1120665113 14:87296909-87296931 GTTAACTGCTTTACTAAATAAGG - Intergenic
1123858811 15:24441768-24441790 GTTACTTGCATGTCTCAAAACGG + Intergenic
1124221116 15:27850624-27850646 TTTATCTCCTTGGCTGAAAAGGG - Intronic
1129200962 15:73999242-73999264 GCTACCTTTTTGGCTAAAAGAGG - Intronic
1130781939 15:87049033-87049055 GTTACCTGCATAGTCAAAAATGG + Intergenic
1135624903 16:23986001-23986023 GTTACCTCTTTGGAAAAAAATGG + Intronic
1135912013 16:26569884-26569906 CTTACCTCATTGGCTAAAAGTGG - Intergenic
1141932198 16:87213255-87213277 GTTATCTGCCTGGCTACGAAAGG + Intronic
1143991435 17:10966711-10966733 GTTATCTATTTGGCTAAAACTGG - Intergenic
1144595157 17:16563615-16563637 CAGACATGCTTGGCTAAAAATGG - Intronic
1145979081 17:29001226-29001248 GTCAGCTGCTTGGTTAGAAAGGG - Intronic
1146512128 17:33459180-33459202 GTTGCCTGCTTGGCTAGCCATGG + Intronic
1152052201 17:77989095-77989117 GTTACTTTCTTGGCTTAAAGTGG + Intergenic
1154341965 18:13510954-13510976 TTTATCTGCTTGGAAAAAAATGG + Intronic
1158259429 18:55590484-55590506 GGTAACTGCTTGGCCAGAAATGG - Intronic
1158562418 18:58526086-58526108 CTTACCCTCTTGGTTAAAAAAGG - Intronic
1161820908 19:6530977-6530999 TATAGCTGCTTGGCTACAAAAGG - Exonic
1167170823 19:47830592-47830614 GAGACCAGCTTGGCTAACAATGG + Intronic
927795149 2:26041571-26041593 GTTAGCTGTTTGGCTTAATAGGG + Intronic
928650497 2:33399177-33399199 GCTAGCAGCTTGGCTAAGAACGG - Exonic
929364513 2:41136844-41136866 GTTACTTGGGAGGCTAAAAAGGG + Intergenic
932769392 2:74492144-74492166 GGTACCAGCTTTGCTCAAAATGG + Exonic
939004477 2:136769827-136769849 GTTTCCTGCATGAATAAAAAAGG + Intronic
947231825 2:227895320-227895342 AATACTTGCTTGTCTAAAAAAGG - Intronic
948797885 2:240413917-240413939 GTTACCTGCTTCTCTAAGAATGG - Intergenic
1169606947 20:7332464-7332486 GTTTCCTGCTTGGTGAAAATTGG + Intergenic
1169636894 20:7702347-7702369 GTTTACTGCCTGGCTAAAATTGG - Intergenic
1173962703 20:47087526-47087548 GTTACCTCGTTAGCTAAATAAGG + Intronic
1178932914 21:36835112-36835134 GTTGCCTGCTCTGCTAGAAATGG - Intronic
1179217444 21:39379928-39379950 GTTACCTGCTACTATAAAAACGG + Intergenic
953038164 3:39231394-39231416 GATACCTCCTTGGCTGAAAGGGG + Intergenic
954058907 3:48052856-48052878 GTTAACTGCTTGGAAAAATATGG + Intronic
957128680 3:76196158-76196180 TTTAGCTTCTTGGCTAAAATGGG - Intronic
957935264 3:86934331-86934353 GTTTCCTGTTTGGCTAAATCTGG + Intergenic
961668895 3:128512917-128512939 GTTACCTATTTGTCTAAAAGTGG + Intergenic
963631175 3:147731998-147732020 GTTAAATGCTTTGCTAAAACAGG - Intergenic
970265002 4:14272571-14272593 GTTTCCTGCTTTGCAAAGAATGG - Intergenic
972016936 4:34258840-34258862 GATAGCTGCTTGGCCAGAAAAGG - Intergenic
975554385 4:75646144-75646166 GTTACTTGCTTTGCTGAAGAAGG - Intronic
975822135 4:78282249-78282271 GTAATTTGCTTGGCTGAAAAAGG + Intronic
977282357 4:95057161-95057183 GTTTCTTGCTTGACTCAAAATGG + Intronic
978767528 4:112419688-112419710 GTATCCTGCATGGCTGAAAATGG + Intronic
980539757 4:134177887-134177909 GTTGCCTGCTTGGCTATTAATGG - Intergenic
980705176 4:136483916-136483938 GTAACCTGCTTTACTCAAAATGG + Intergenic
981497978 4:145414905-145414927 TTTTCCTTCCTGGCTAAAAATGG - Intergenic
982219985 4:153115985-153116007 ATTACCTCTGTGGCTAAAAACGG - Intergenic
985957084 5:3273872-3273894 GATACTTGGTGGGCTAAAAATGG - Intergenic
986998276 5:13632433-13632455 AATTCCTGCTTGGATAAAAAAGG + Intergenic
988126741 5:27049321-27049343 GTTACCTGCTTGGCATATAGTGG + Intronic
992270486 5:75057833-75057855 GTTACCTGCTTGCCAAGCAAAGG - Intergenic
995872297 5:116756123-116756145 GTTTCAGCCTTGGCTAAAAAGGG + Intergenic
996606886 5:125333893-125333915 GTTACATGATTGGGTAAAATTGG - Intergenic
996857430 5:128024709-128024731 GTTTCCTGCTTGGTAAAACAAGG - Intergenic
997296094 5:132769462-132769484 GTTACCTGCCTGGCTTCTAAAGG - Intronic
998468902 5:142367746-142367768 GTTCTCTGCTTGGCTAAAGGTGG + Intergenic
999015634 5:148101345-148101367 TTCTTCTGCTTGGCTAAAAAAGG - Exonic
1001094171 5:168763199-168763221 ATTACCTGCTGGGGTAATAAAGG - Intronic
1001316909 5:170649745-170649767 GGTACCTGCTTGGTTACAACAGG - Intronic
1001557815 5:172648158-172648180 GTCACTTGTCTGGCTAAAAAGGG - Intronic
1005275499 6:24212324-24212346 GATACCTGCTGGGCAAAAACAGG + Intronic
1008645345 6:53508548-53508570 TTTACCTGCTTGACTTAAAAGGG + Intronic
1010141274 6:72617754-72617776 GTTAGCTGCTGGAATAAAAATGG + Intergenic
1012323945 6:97890060-97890082 GTTGCTTGCATGACTAAAAATGG + Intergenic
1014086616 6:117353353-117353375 GTTACCTGATTGGCTTGATATGG - Intronic
1014963444 6:127716282-127716304 GTTATCTTCCTGGCTAAACAGGG - Intronic
1018601943 6:165553403-165553425 TTTTCCTTCTTGGTTAAAAATGG - Intronic
1024245615 7:47467683-47467705 GGTACCTGCTTCTCTAAAATAGG + Intronic
1027258276 7:76445130-76445152 GTTACCTGCTAAGCTAGAAGTGG - Intergenic
1027280572 7:76606889-76606911 GTTACCTGCTAAGCTAGAAGTGG + Intergenic
1029800628 7:102943670-102943692 GGTATCTGCTTGGCTACACAGGG - Intronic
1030158026 7:106476640-106476662 ATTACCTTCTTTGCTGAAAAAGG - Intergenic
1031527746 7:122842033-122842055 GTTACCTCCTAGGCTGGAAAAGG + Intronic
1034239107 7:149596130-149596152 GTTTCCTGCTTGCCTTCAAATGG + Intergenic
1035862872 8:3048893-3048915 GTTAACAACCTGGCTAAAAATGG + Intronic
1037499287 8:19469946-19469968 GGAAGGTGCTTGGCTAAAAAGGG + Intronic
1039126456 8:34207629-34207651 GTTACCCTCTTGACTAAAACTGG + Intergenic
1039716878 8:40119279-40119301 GGCACATGCTTTGCTAAAAAAGG - Intergenic
1040044762 8:42951410-42951432 GTTTCCTGTTTGGCAGAAAATGG + Intronic
1046758591 8:117996854-117996876 GTTAGCTGCTTGGCCCAGAATGG - Intronic
1047343791 8:124007695-124007717 GTTACCTGCTTGGCTAAAAATGG - Intronic
1054715987 9:68558174-68558196 GATACCTGATTGTCTAAAAATGG + Intergenic
1056877382 9:90347587-90347609 GTTTCCTGCTTGACTCAAATTGG - Intergenic
1058198475 9:102008625-102008647 GTTGCCTGCTTGGCCACCAATGG - Intergenic
1058198518 9:102008933-102008955 GTTGCCTGCCTGGCTACCAATGG - Intergenic
1058255100 9:102752018-102752040 GTTACCTGCTTAGGAACAAAAGG - Intergenic
1058637559 9:107051039-107051061 GTTCCCTGCTTGCCCTAAAAAGG + Intergenic
1059160598 9:112031412-112031434 GTTACCTGATTTTTTAAAAATGG + Intergenic
1188846296 X:35076496-35076518 GGTACCAGCTTGGCTACAACAGG - Intergenic
1189215455 X:39319276-39319298 GCTTCCTGCTTGTCTAGAAAAGG - Intergenic
1189873056 X:45404551-45404573 GTTACCTGCCTGGCTACCAATGG - Intergenic
1190146051 X:47892566-47892588 GTTGGCTGGTTGGCTAAACATGG - Intronic
1191197161 X:57736831-57736853 GTTACCAGCTTGGCCAAAGTTGG + Intergenic
1197732317 X:129821611-129821633 GTTTCCTGCTTCACTTAAAATGG + Intronic
1199559643 X:149149186-149149208 AGTACCTGCTTGTCTGAAAAAGG + Intergenic