ID: 1047343985

View in Genome Browser
Species Human (GRCh38)
Location 8:124009670-124009692
Sequence CAATGACCCTCAGACTTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 2, 2: 4, 3: 25, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047343985_1047343995 30 Left 1047343985 8:124009670-124009692 CCTTTGAAGTCTGAGGGTCATTG 0: 1
1: 2
2: 4
3: 25
4: 164
Right 1047343995 8:124009723-124009745 CTGTTCTAGGGTGAGAGTTGAGG No data
1047343985_1047343989 -8 Left 1047343985 8:124009670-124009692 CCTTTGAAGTCTGAGGGTCATTG 0: 1
1: 2
2: 4
3: 25
4: 164
Right 1047343989 8:124009685-124009707 GGTCATTGATCGGGAGGTCCAGG No data
1047343985_1047343991 2 Left 1047343985 8:124009670-124009692 CCTTTGAAGTCTGAGGGTCATTG 0: 1
1: 2
2: 4
3: 25
4: 164
Right 1047343991 8:124009695-124009717 CGGGAGGTCCAGGAAGGAGCTGG No data
1047343985_1047343993 17 Left 1047343985 8:124009670-124009692 CCTTTGAAGTCTGAGGGTCATTG 0: 1
1: 2
2: 4
3: 25
4: 164
Right 1047343993 8:124009710-124009732 GGAGCTGGTGCTGCTGTTCTAGG No data
1047343985_1047343994 18 Left 1047343985 8:124009670-124009692 CCTTTGAAGTCTGAGGGTCATTG 0: 1
1: 2
2: 4
3: 25
4: 164
Right 1047343994 8:124009711-124009733 GAGCTGGTGCTGCTGTTCTAGGG No data
1047343985_1047343990 -4 Left 1047343985 8:124009670-124009692 CCTTTGAAGTCTGAGGGTCATTG 0: 1
1: 2
2: 4
3: 25
4: 164
Right 1047343990 8:124009689-124009711 ATTGATCGGGAGGTCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047343985 Original CRISPR CAATGACCCTCAGACTTCAA AGG (reversed) Intronic
900010437 1:102384-102406 AACTGCCCCTCAGACTTCCAGGG - Intergenic
900026542 1:278949-278971 AACTGCCCCTCAGACTTCCAGGG - Intergenic
900036328 1:412792-412814 AACTGCCCCTCAGACTTCCAGGG - Intergenic
900057956 1:648547-648569 AACTGCCCCTCAGACTTCCAGGG - Intergenic
900836121 1:5005501-5005523 CATTGACCATCAGATCTCAAGGG + Intergenic
903782512 1:25830443-25830465 CAAAGACCCTCATACTCCATCGG - Intronic
905237858 1:36562392-36562414 CAAAGACCCACAGACACCAAGGG - Intergenic
906011432 1:42530836-42530858 CAATCTCCCTCAGATATCAAGGG + Intronic
919125991 1:193394478-193394500 CAATTTTCCTCAGACTTCAAAGG - Intergenic
919563733 1:199157728-199157750 AAATGACCCTCAAACCCCAAGGG - Intergenic
919942178 1:202295840-202295862 CAATTACCCTCAGACTGCCCTGG - Intronic
920033551 1:203051329-203051351 CAAAGACCCTCAGAGTGAAAAGG + Exonic
920372648 1:205489261-205489283 CCAGGAACCTCAGACTTCAGAGG + Intergenic
921654593 1:217719809-217719831 CAATGCAATTCAGACTTCAATGG + Intronic
921695129 1:218200589-218200611 CATTGAACCTCAGAATTAAAAGG + Intergenic
922258876 1:223918390-223918412 AACTGCCCCTCAGACTTCCAGGG - Intergenic
922859276 1:228802168-228802190 CAATGGCCCTTAGACATTAATGG + Intergenic
923817836 1:237400437-237400459 CAGTGGCCCTCAGACTGGAAGGG + Intronic
924340065 1:243021139-243021161 AACTGCCCCTCAGACTTCCAGGG - Intergenic
1069855948 10:71441081-71441103 CAAAGACTCTCAGAGTGCAAGGG + Intronic
1071667641 10:87576436-87576458 CACTGACCCTCTGCCCTCAATGG + Intergenic
1072038859 10:91589195-91589217 CAATGAGCCTGAGAATTCTAAGG + Intergenic
1073117383 10:101099232-101099254 CCATGACCCTGAGCTTTCAAGGG - Intronic
1073183239 10:101598992-101599014 CAAGCACCCTTAGACTCCAATGG - Intronic
1076508191 10:130992883-130992905 CAAGCACCCAAAGACTTCAAGGG + Intergenic
1080695578 11:34600585-34600607 CACTCACCCACAGACTTCCAAGG + Intergenic
1084280913 11:68092665-68092687 CAATGACCAACAGTCTCCAATGG + Intronic
1086461646 11:87011730-87011752 CAATGACCCTCACACTTTGATGG - Intergenic
1096975391 12:55696864-55696886 AAATGACCCTCAGAAGCCAAGGG + Intronic
1103565433 12:121812948-121812970 CACTCCCCCTCAGCCTTCAAAGG + Intronic
1104665498 12:130644655-130644677 TAATCACCGTCAGACTTCAGGGG + Intronic
1106726836 13:32495162-32495184 CCATGAGTCTCAGACTTCAAAGG + Intronic
1107642613 13:42459329-42459351 CAATGATCCTCATCCTTCAATGG + Intergenic
1107647503 13:42510208-42510230 CAATGATCCTGATCCTTCAATGG - Intergenic
1113694221 13:112332606-112332628 CAATTACCGGCAGACTGCAAAGG + Intergenic
1117743257 14:58841043-58841065 TGATGACCCTTAGACTTCTAGGG - Intergenic
1118824619 14:69368878-69368900 GAATGACACTAACACTTCAAGGG + Intergenic
1120842195 14:89095759-89095781 CACTGAGCCTGAGACTTCAGTGG - Intergenic
1121676481 14:95757431-95757453 CTGTGACCCTGTGACTTCAAAGG - Intergenic
1122245618 14:100401386-100401408 CCACGACACTCAGACCTCAATGG - Intronic
1125383232 15:39109923-39109945 CAATGATCCTAAGACTACCATGG + Intergenic
1126394507 15:48199653-48199675 CAATGACTCTGAGACTTAACTGG - Intronic
1127327309 15:57908120-57908142 CAATGTCCCTCTGACATCCAAGG - Intergenic
1128631422 15:69272393-69272415 TAAGGACCCTTAGTCTTCAAGGG + Intergenic
1131875328 15:96799750-96799772 TAATGACTCTGAGACATCAAAGG + Intergenic
1134109048 16:11503391-11503413 CAGTGAGCCTGAGACTTCAGGGG - Intronic
1134344621 16:13378189-13378211 TAATGACCCACATACTTGAATGG + Intergenic
1135855073 16:26002215-26002237 AAATGATCCTCAGATTTCATAGG - Intronic
1139361867 16:66404447-66404469 CAAAGCCCCTCACACTGCAAGGG + Exonic
1140666217 16:77229979-77230001 CAAGGGCCCTCAGGCTTAAAGGG - Intergenic
1142453904 16:90204526-90204548 AACTGCCCCTCAGACTTCCAGGG + Intergenic
1142896127 17:2980344-2980366 CAGTGTCCCTCAGATTGCAAAGG + Exonic
1144390697 17:14790937-14790959 CAATTACCCTCATATGTCAAAGG - Intergenic
1147035322 17:37675599-37675621 CAATGACCCTAAGCCCTGAATGG + Intergenic
1150599271 17:66636536-66636558 TAATCACCCTCAGGCTTCATAGG - Intronic
1153493892 18:5677648-5677670 AAGTGACCCTCAGACCTCAGTGG - Intergenic
1160748713 19:723503-723525 CAGCGACCCTCAGGCTTCCAAGG - Intronic
1161746452 19:6063223-6063245 CAAGGACCCTCTGATTCCAACGG + Intronic
1162444418 19:10713411-10713433 CAATGACGCTCAGACTGGGAGGG - Intronic
1164580937 19:29434482-29434504 GAACGTCCATCAGACTTCAAAGG + Intergenic
1167059224 19:47133001-47133023 CATTGAGCCTCAGACTTATATGG + Intronic
926862090 2:17320540-17320562 ACAGGACACTCAGACTTCAATGG + Intergenic
927207914 2:20621599-20621621 CAGGTACCCTCAGCCTTCAATGG - Intronic
927467566 2:23348528-23348550 GAATGACACACAGACTTCAGGGG + Intergenic
930146349 2:48009496-48009518 AATTGAGCCTGAGACTTCAAGGG + Intergenic
933177148 2:79187951-79187973 CAACTAGCCTCAGACTTAAAAGG + Intronic
936016478 2:108962853-108962875 CAAAGATCCTCACTCTTCAATGG + Intronic
936022476 2:109005422-109005444 GAATGACCCTGAGACTTGGAGGG - Intergenic
938376071 2:130807700-130807722 CAATCACCCTCAGCCTGCACTGG + Intergenic
940088477 2:149888968-149888990 CAATAAACATCAGATTTCAATGG - Intergenic
943123569 2:183768505-183768527 CAATGATCCTCAGATCTCATAGG - Intergenic
943203385 2:184859924-184859946 CCATGAGCCTGAGTCTTCAAGGG + Intronic
943436448 2:187869947-187869969 CAACGACTCTCAGACTTAAAAGG + Intergenic
947409304 2:229818882-229818904 CAATGATGCCCATACTTCAAAGG + Intronic
948247218 2:236496666-236496688 CAGTGGGCCTCAGACATCAAAGG - Intronic
949070293 2:242020392-242020414 CAACGACTCTCAGACTTAAAAGG - Intergenic
949085356 2:242149189-242149211 AACTGCCCCTCAGACTTCCAGGG + Intergenic
1172398199 20:34624964-34624986 CAATGCTCCCCAGACTTCCATGG - Intronic
1172623468 20:36334432-36334454 CTATGCCCCTCAGACCTCAATGG - Intronic
1174060925 20:47832618-47832640 CAATGACTCTCAGACTTGGGAGG + Intergenic
1174060976 20:47832931-47832953 CAACAACCCTCAGACTTGAGAGG + Intergenic
1174061047 20:47833357-47833379 CAATGACTCTCAGATTTGAAAGG + Intergenic
1174061185 20:47834112-47834134 CCATGACCCTCTGACTTAAATGG + Intergenic
1174061262 20:47834586-47834608 AAGTGACTCTCAGACTTCAAAGG + Intergenic
1174070514 20:47896113-47896135 CAGTGACTCTCAGACTTCAAAGG - Intergenic
1174070591 20:47896587-47896609 CCATGACCCTCTGACTTAAATGG - Intergenic
1174070728 20:47897342-47897364 CAATGACTCTCAGATTTGAAAGG - Intergenic
1174070806 20:47897765-47897787 CCACGACCCTCTGACTTAAATGG - Intergenic
1174070921 20:47898439-47898461 CAACAACCCTCAGACTTGAGAGG - Intergenic
1174070973 20:47898752-47898774 CAATGACTCTCAGACTTGGGAGG - Intergenic
1174100132 20:48121030-48121052 CAATGACTCTCAGACTTGGGAGG + Intergenic
1174100181 20:48121343-48121365 CAACAACCCTCAGACTTGAGAGG + Intergenic
1174100346 20:48122226-48122248 CCACGACCCTCTGACTTAAAGGG + Intergenic
1174100371 20:48122387-48122409 CAATGACTCTCAGACTTGAAAGG + Intergenic
1174100658 20:48124008-48124030 CCACAACCCTCTGACTTCAATGG + Intergenic
1174101058 20:48126459-48126481 CAATGACTCTCAGACTTCAAAGG + Intergenic
1174149638 20:48476996-48477018 CCATGACCTTCAGACTTGAACGG + Intergenic
1174149647 20:48477046-48477068 CCATGACCTTCAGACTTGAACGG + Intergenic
1174153085 20:48499906-48499928 CAATGACTCTCAGACTTGGGAGG + Intergenic
1174153139 20:48500219-48500241 CAACAACCCTCAGACTTGAGAGG + Intergenic
1174153259 20:48500891-48500913 CCATGATCCTCTGACTTAAATGG + Intergenic
1174153335 20:48501314-48501336 CAACGACTCTCAGATTTGAAAGG + Intergenic
1174153623 20:48503001-48503023 AAATGACTCTCAGACTGGAAAGG + Intergenic
1174156126 20:48516477-48516499 CAATGACTCTCACACTTCAATGG + Intergenic
1176696724 21:9986665-9986687 CTATGGCCCCCAGATTTCAATGG + Intergenic
1182120881 22:27785899-27785921 CAATGTCCATTAGACTTTAACGG + Intronic
1182626977 22:31654676-31654698 GAATGATCCTCAGATTTCATTGG - Intronic
952755396 3:36861319-36861341 TAATGACCTTGAGACTTCATGGG + Intronic
957540114 3:81557406-81557428 AAATGACTCCCAGATTTCAATGG + Intronic
960695936 3:120396403-120396425 CAGTGTCCCTCAGACTTGGATGG - Exonic
962146152 3:132842270-132842292 CAATGCACCTCACCCTTCAATGG + Intergenic
962909355 3:139833817-139833839 CCATGACTGTCATACTTCAAAGG - Intergenic
963807276 3:149736247-149736269 CAATGAAACTCAGACTTCCCTGG + Intronic
963975270 3:151473320-151473342 GAATCACCCTGAGACTCCAAGGG + Intergenic
965512611 3:169585159-169585181 CAATGACCATCTGTCTTAAATGG + Intronic
967268703 3:187715073-187715095 AAATGGCCCCCAGACTTCCATGG + Intronic
970365549 4:15354479-15354501 CCATGACCCTCAGATGTCATGGG - Intronic
977389676 4:96391667-96391689 TACTGACCTTCAGAGTTCAATGG + Intergenic
979262788 4:118667437-118667459 AACTGCCCCTCAGACTTCCAGGG + Intergenic
980369330 4:131846843-131846865 CTATGGCCCCCAGATTTCAATGG + Intergenic
981703808 4:147638130-147638152 CCATAACCCTCAGTCTTCAGTGG + Exonic
984106104 4:175548189-175548211 AAATAACACTCTGACTTCAATGG + Intergenic
984299047 4:177891614-177891636 CAATGAAGCACAGTCTTCAAAGG + Intronic
985299550 4:188473342-188473364 CAATGTCCCTGAGACCTCCAGGG - Intergenic
986503580 5:8427226-8427248 GAATCACCCTCAGACTGAAAAGG - Intergenic
988424552 5:31048593-31048615 AAATGACCCTGAAACATCAAGGG + Intergenic
988947090 5:36215098-36215120 CAATCCCCCTCAGACACCAAGGG + Intronic
991648480 5:68826512-68826534 CTCTAACCCCCAGACTTCAAGGG + Intergenic
991997526 5:72402726-72402748 GAATGCCCCTCAGGCTTCCATGG - Intergenic
991998149 5:72408671-72408693 CAAGTAGTCTCAGACTTCAATGG - Intergenic
993264470 5:85706393-85706415 CAATGACTTTCAAACTTCAGTGG - Intergenic
994918462 5:106010268-106010290 CAATGAGCATAAGACTTCATGGG - Intergenic
995533671 5:113114943-113114965 CACTGACCCTCTGCCTTCAGTGG + Intronic
998256348 5:140591632-140591654 CAAGCACCCTCAGACTCCACTGG + Intronic
998523434 5:142820872-142820894 CAAGGAAACTCAGACTTCAAGGG + Intronic
999626150 5:153522496-153522518 AAATGACCCCCAAACTTCCATGG + Intronic
999976768 5:156919623-156919645 CAATTACCCTTAAAGTTCAAAGG + Intronic
1001599128 5:172917540-172917562 CAATGCTCCTCAAACTTCAGTGG - Intronic
1002737493 5:181406072-181406094 AACTGCCCCTCAGACTTCCAGGG + Intergenic
1008981298 6:57487036-57487058 CAATGACTATAAAACTTCAAGGG - Intronic
1011383422 6:86767354-86767376 CACTGAGCCACAGACTACAAGGG + Intergenic
1016223633 6:141706891-141706913 CAATGACCCCCAAACTTCAATGG - Intergenic
1016900595 6:149097145-149097167 CTATGAAACTCAGACTTGAATGG + Intergenic
1017009271 6:150052389-150052411 CAATGATTCTCAGACTTGAGAGG + Intergenic
1017009327 6:150052717-150052739 CAATGACTCTCAGACTTGAGAGG + Intergenic
1017009355 6:150052883-150052905 CCATGACCCTAAGACATGAATGG + Intergenic
1017009411 6:150053204-150053226 TAACGACTCTCAGACTTGAAAGG + Intergenic
1017009535 6:150053954-150053976 CCATGACCCTCTGACTTAAATGG + Intergenic
1017009791 6:150055491-150055513 CTATGACCCTCAAACTACAACGG + Intergenic
1017009802 6:150055544-150055566 CAATGACTCTCAGACCTGAAAGG + Intergenic
1018452271 6:163920073-163920095 CATTTACCCACAGAGTTCAAAGG - Intergenic
1018508713 6:164501073-164501095 CAATCACCCACAGATTACAAGGG + Intergenic
1019242590 6:170681627-170681649 AACTGCCCCTCAGACTTCCAGGG + Intergenic
1019299240 7:295295-295317 CAAGGAGCCTCAGACTCCAGTGG - Intergenic
1022969986 7:35508021-35508043 CAGTGATCCTCAAACTTCAGGGG + Intergenic
1024009180 7:45253171-45253193 CAGTGTCCCTCAGACCTCAAGGG - Intergenic
1025233162 7:57216494-57216516 CAATGACTCTCAGACTTCAAAGG - Intergenic
1025233335 7:57217520-57217542 CAATGACTCCCAGACTTGAAAGG - Intergenic
1025233569 7:57218878-57218900 CCATGACCCTCTGACTTAAATGG - Intergenic
1025233767 7:57220005-57220027 CCATGACCCTCTGACTTAAATGG - Intergenic
1025234009 7:57221399-57221421 CAATGACTCTCAGACTTGGGAGG - Intergenic
1031381085 7:121086913-121086935 CAATGACCATCACTCTTCACTGG + Intronic
1033683153 7:143616249-143616271 CAATGAACCTGATATTTCAAAGG + Intergenic
1033701459 7:143841389-143841411 CAATGAACCTGATATTTCAAAGG - Intergenic
1035236147 7:157498817-157498839 AAATGACCTTCAGAATTCAACGG + Intergenic
1035505530 8:126526-126548 AACTGCCCCTCAGACTTCCAGGG - Intergenic
1036077517 8:5517919-5517941 CAAGGACTCTCAGGCTTTAAAGG - Intergenic
1039286771 8:36050189-36050211 CAATAACCCTCAATCTTTAATGG - Intergenic
1041129199 8:54679235-54679257 AAATGACTCTAAGACTGCAAGGG - Intergenic
1044837603 8:96311644-96311666 CAATGGCCCTTAGTCTTCTAAGG - Intronic
1045415646 8:101964348-101964370 CAATAACCCTCTGATTTCATTGG + Intronic
1046616019 8:116478253-116478275 CAATCTCCCACTGACTTCAAAGG + Intergenic
1047343985 8:124009670-124009692 CAATGACCCTCAGACTTCAAAGG - Intronic
1049832363 8:144710093-144710115 GAATGACCCTCTGTCTTCCAAGG + Intergenic
1051582567 9:18693857-18693879 CACTGACCCTCAGACCTAATAGG - Intronic
1052975981 9:34410460-34410482 GAATGACCCGCAGACTTTTATGG + Intronic
1053017296 9:34669605-34669627 CATGGACCCTCAGTCTTCCAAGG - Intergenic
1053506724 9:38649604-38649626 CAAAGGCCCTCAGGCGTCAAGGG + Intergenic
1053633701 9:39972511-39972533 CTATGGCCCCCAGATTTCAATGG + Intergenic
1053772049 9:41490989-41491011 CTATGGCCCCCAGATTTCAATGG - Intergenic
1054210186 9:62278186-62278208 CTATGGCCCCCAGATTTCAATGG - Intergenic
1054314805 9:63570741-63570763 CTATGGCCCCCAGATTTCAATGG + Intergenic
1056731638 9:89170953-89170975 CAATCCCCCTCAGATCTCAAGGG + Intronic
1058728319 9:107824881-107824903 CATGGACCCTCACCCTTCAAGGG + Intergenic
1061865827 9:133491349-133491371 CAATGACACTCAGACTGGACAGG + Intergenic
1203602781 Un_KI270748v1:30851-30873 AACTGCCCCTCAGACTTCCAGGG + Intergenic
1186231272 X:7457028-7457050 GTGTGACCCACAGACTTCAAGGG + Intergenic
1187105788 X:16239973-16239995 CAATGACCTTCAGAATGCGATGG + Intergenic
1188348599 X:29099305-29099327 TTATGGCCTTCAGACTTCAAAGG - Intronic
1190451335 X:50584227-50584249 CAATGACCCTCAGTTTTCAGTGG - Intergenic
1192609500 X:72553618-72553640 CAATCACCCACAGATATCAAGGG - Intronic
1194760710 X:97793182-97793204 AAATGCCCCTCTGACTTCAGAGG - Intergenic
1197647836 X:129037031-129037053 CAATGGTTCTCACACTTCAATGG + Intergenic
1201233054 Y:11884221-11884243 CATTTATCCTCAGACTTCCAAGG + Intergenic
1202384853 Y:24315896-24315918 AACTGCCCCTCAGACTTCCAGGG + Intergenic
1202485932 Y:25354226-25354248 AACTGCCCCTCAGACTTCCAGGG - Intergenic