ID: 1047343992

View in Genome Browser
Species Human (GRCh38)
Location 8:124009703-124009725
Sequence CAGCAGCACCAGCTCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 887
Summary {0: 3, 1: 6, 2: 40, 3: 137, 4: 701}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047343992_1047343995 -3 Left 1047343992 8:124009703-124009725 CCAGGAAGGAGCTGGTGCTGCTG 0: 3
1: 6
2: 40
3: 137
4: 701
Right 1047343995 8:124009723-124009745 CTGTTCTAGGGTGAGAGTTGAGG No data
1047343992_1047343996 16 Left 1047343992 8:124009703-124009725 CCAGGAAGGAGCTGGTGCTGCTG 0: 3
1: 6
2: 40
3: 137
4: 701
Right 1047343996 8:124009742-124009764 GAGGAGCTGCAGACCCAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047343992 Original CRISPR CAGCAGCACCAGCTCCTTCC TGG (reversed) Intronic
900188389 1:1343321-1343343 CAGCAGCAGCTGCACCTACCGGG + Intronic
900207547 1:1438069-1438091 CTCCAGCCCCAGCTCCTTCAGGG - Intronic
900242723 1:1624654-1624676 CCGCAGCCCCAGCTCTTGCCCGG - Intronic
900345292 1:2207591-2207613 CTGCATCTCCAGCTCCTGCCAGG - Intronic
900354232 1:2252338-2252360 CAGCAGCCACAGCACCCTCCTGG - Intronic
900431764 1:2606076-2606098 CAGCAGCAGCAGCTCGTTCCCGG + Intronic
900458618 1:2789622-2789644 CAGCAGCCCCCGCTGGTTCCAGG + Exonic
900615248 1:3562827-3562849 CAGCAGCAACACCTCCCTCTGGG + Intronic
900814387 1:4832196-4832218 CACCAGCACCCTCACCTTCCAGG - Intergenic
900985771 1:6072124-6072146 CAGCTGCCCGGGCTCCTTCCCGG - Intronic
901005252 1:6168625-6168647 TATCAGCCCCAACTCCTTCCTGG - Intronic
901219214 1:7573552-7573574 CAGCAGGGCCAGTTCCTTCCAGG + Intronic
901617880 1:10556226-10556248 CAGTATCACCAGCTCCAGCCAGG - Intronic
901829481 1:11883394-11883416 CAGCAGCTCCAACACATTCCTGG + Intergenic
902038623 1:13475923-13475945 CATCATCTCCAGCTTCTTCCTGG - Exonic
902087980 1:13877814-13877836 CAGCAGCACCAGTGTCTCCCGGG + Intergenic
902579107 1:17397169-17397191 CTGCGGCACCAGCTCTTTCTTGG - Intronic
902595729 1:17508315-17508337 CAACAGCAGCAGCCCCTTCTAGG + Intergenic
902822784 1:18953739-18953761 CAGCAGCACCGTCTCATTCCAGG + Intronic
903854921 1:26331437-26331459 CAGCAGCAACTTCTGCTTCCGGG + Intronic
903857408 1:26345209-26345231 CCCCTGCACCACCTCCTTCCGGG + Exonic
904454052 1:30636368-30636390 CAGCCCCACCAGATCTTTCCTGG - Intergenic
904657943 1:32063237-32063259 CACCAGGCCCAACTCCTTCCTGG - Intergenic
904677378 1:32206612-32206634 CTTCAGCACCATCTCCTCCCAGG - Exonic
904684186 1:32248688-32248710 CAGAGGCACCAGCTCCTGGCGGG + Exonic
905391892 1:37641328-37641350 CTGCAACACCAGCTCTTCCCTGG + Intergenic
905659763 1:39712490-39712512 TGGCAGCAGCAGCACCTTCCTGG + Intronic
905917581 1:41696339-41696361 CATCAACAGCAGCCCCTTCCTGG + Intronic
905974629 1:42165551-42165573 CAGCAGCTCCTGGTCCTCCCTGG + Intergenic
906149451 1:43579062-43579084 CAGCAGCAACAGCTCCCACTGGG + Intronic
906223642 1:44103393-44103415 CAGCCGCACCAGCTCCACCAGGG - Intergenic
906238579 1:44227520-44227542 CAGCCCCACCAGCTCCATACAGG + Intronic
906321860 1:44822306-44822328 CAGCAGCAGCAGGGCCCTCCAGG + Exonic
908219509 1:61990307-61990329 CTGCGGCAGCAGGTCCTTCCGGG - Exonic
908431348 1:64061602-64061624 CAGCAGCACCAGCACCCCCTGGG - Intronic
908691157 1:66781465-66781487 CAGCTCCACCAGCTCCTTTAAGG - Intergenic
908840939 1:68279481-68279503 CAACAGCATCATCTCCTTCTGGG - Intergenic
913201354 1:116497356-116497378 GAGCAGCACCAGGTCGGTCCTGG + Intergenic
913255530 1:116949935-116949957 GAAAAGCACCAGCTCCTGCCAGG - Intronic
913671181 1:121098138-121098160 CAGCTGCATCAGATCCCTCCAGG - Intergenic
914022951 1:143885559-143885581 CAGCTGCATCAGATCCCTCCAGG - Intergenic
914661438 1:149793503-149793525 CAGCTGCATCAGATCCCTCCAGG - Intronic
914676323 1:149909742-149909764 CTGCAGCCCCAGCCCCTACCTGG - Intronic
915619868 1:157074608-157074630 CAGCCGCACCAGCTCCTCGAGGG + Intergenic
915835323 1:159171605-159171627 CAGCAGCGCCGGCTCCCTCCCGG + Exonic
916663825 1:166947727-166947749 CAGCTGCTCCGGCTCCTGCCCGG + Intronic
916988221 1:170214369-170214391 CAGCGGGAGCACCTCCTTCCTGG + Intergenic
917525139 1:175781718-175781740 CAACAGCACCAGCACCACCCAGG + Intergenic
919945434 1:202315821-202315843 AAGCAGCACCTGCTTCCTCCAGG - Intronic
920049932 1:203157770-203157792 CAGCAGCACAAGCTACATCTGGG + Intronic
920147257 1:203872660-203872682 CAGCCGCACCAGCTTCTCCAGGG - Intergenic
920217163 1:204369103-204369125 CAGCAAGCCCAGCTCCTGCCAGG + Intronic
920312692 1:205058005-205058027 CAGCAACACCTGCTCCTCCGTGG - Exonic
920674565 1:208030155-208030177 CAGCTGCAGCAGCTTCTCCCAGG - Intronic
920683688 1:208092809-208092831 CCCCACCACCTGCTCCTTCCAGG - Exonic
920996498 1:210997311-210997333 CAGCTGCATCAGCTCCTTTAAGG - Intronic
921127180 1:212188249-212188271 AAGCAGCACCAGCACCAGCCGGG + Intergenic
921260210 1:213379508-213379530 CAGCAGCATGAGTTCCTTCTTGG - Intergenic
921586875 1:216957649-216957671 CAGCACCAGCATCTCCCTCCTGG + Intronic
922322120 1:224498080-224498102 CTGCAGCAGCAGTGCCTTCCTGG + Intronic
922786988 1:228287718-228287740 CAGCACCTCCAGGTCCTTCAGGG - Exonic
922897123 1:229109052-229109074 AAGCAGCAGCAGCAGCTTCCGGG - Intergenic
924032920 1:239905233-239905255 CCTCTCCACCAGCTCCTTCCAGG - Intronic
1062932788 10:1363706-1363728 CAGCTGCACCAGCGCGTTCTTGG + Exonic
1063011221 10:2023500-2023522 CTGCAGCACGAGGTCCTTCTGGG + Intergenic
1064409291 10:15091461-15091483 CAGCAGGACCTGGTCCATCCCGG - Intergenic
1064598329 10:16968590-16968612 CAGCAGCACCAGCTGGCCCCTGG - Intronic
1065186140 10:23172722-23172744 CAGCTTCCCCAGCTCCCTCCTGG + Intergenic
1065695233 10:28373646-28373668 TAGCAGCACCTGCTCTTCCCTGG + Intergenic
1065812604 10:29456059-29456081 TAGCAACTCAAGCTCCTTCCTGG + Intergenic
1065959079 10:30719486-30719508 TAGCAACTCGAGCTCCTTCCTGG - Intergenic
1066314464 10:34230293-34230315 CAGCAGCAGCAGGTACTACCTGG + Intronic
1067795555 10:49318895-49318917 CAGAAGCCCCAGATCCTGCCTGG - Intronic
1069628519 10:69882873-69882895 CAGCCCCCTCAGCTCCTTCCAGG + Intronic
1070617679 10:77981578-77981600 GAGCAGAAGCAGCCCCTTCCGGG + Intronic
1070893147 10:79957449-79957471 CAGCTCCACCAGCTCCTTTAAGG - Intronic
1071509811 10:86254367-86254389 CAGCAGCACCAGCATCTCCTGGG + Intronic
1071597424 10:86938478-86938500 CAGCAGGACTGGCTTCTTCCTGG - Intronic
1071604546 10:86976063-86976085 CCGCTGCACCAGCTCCCTACTGG + Intronic
1071771023 10:88728821-88728843 CAGCCGCACCAGCTCCTGCAGGG + Intronic
1072194706 10:93107226-93107248 CAGCAACACCAGCTTGTCCCTGG + Intergenic
1072694280 10:97591303-97591325 CACCAGCCCCACCTGCTTCCTGG + Intronic
1072915148 10:99533195-99533217 CAGCAGCACCAGCACTTCCATGG + Exonic
1073383500 10:103100871-103100893 CAGCACCAGCAGCTCCATGCAGG - Intronic
1073513858 10:104060177-104060199 GAGCAGCTCCATCTCCTTCTTGG + Exonic
1074365017 10:112850789-112850811 TAGCAACACCAGCGCCTTCTTGG + Intergenic
1074984411 10:118644112-118644134 CAGCAGCAGCAGATACTTCTAGG + Intergenic
1075044165 10:119133072-119133094 CCGCAGAGCCAGCTCCTTGCTGG + Intronic
1075066345 10:119291486-119291508 CAGCAGCAGCAGTTCCTTCCTGG - Intronic
1075360445 10:121827489-121827511 CAGCAGGATGAGCTCCTCCCAGG + Intronic
1075477602 10:122749902-122749924 CAGCAGCCTCACCTCCATCCAGG - Intergenic
1075478397 10:122756709-122756731 CAGCAGCCTCACCTCCATCCAGG - Intergenic
1075479126 10:122764335-122764357 CAGCAGCCTCACCTCCCTCCAGG - Intergenic
1075587288 10:123667036-123667058 CAGCAGCACCAGCGTCTGCATGG - Exonic
1076248000 10:128962364-128962386 GAGCAGCCCCATCTCCTTCGAGG - Intergenic
1076265070 10:129103364-129103386 TGGCAGCACCGGCTCCTTCCTGG + Intergenic
1076547100 10:131252757-131252779 CAGGAGCAGCAGCTGCTTCCCGG - Intronic
1076741551 10:132488239-132488261 CAGGAGTCCCAGCTCCATCCAGG + Intergenic
1076787897 10:132760156-132760178 CTGCAGCACCTGCTGCTTCTAGG + Intronic
1076847316 10:133075648-133075670 CCCCAGCCCCAGCTGCTTCCTGG - Intronic
1076849222 10:133084888-133084910 CAGCAACAGCAGCTCCTGCCTGG + Intronic
1077209246 11:1360851-1360873 CACAAGCACCAGTGCCTTCCAGG - Intergenic
1077273372 11:1692162-1692184 CAGCAGCAGCCGCTGCTTCCTGG - Intergenic
1078190801 11:9091472-9091494 CAGCAGCAGCAGCACCGCCCAGG + Exonic
1078313880 11:10274985-10275007 CAGCAGAACCACCACCATCCTGG + Intronic
1079231311 11:18651221-18651243 CAGCAGCCGCAGCTTCCTCCCGG - Intergenic
1080441196 11:32296194-32296216 CAGCTGCACCAGCTCCTGCTAGG - Intergenic
1080603351 11:33842521-33842543 CTTTACCACCAGCTCCTTCCTGG - Intergenic
1081493150 11:43582282-43582304 CAGCAGCAGCAGCCCCATCCCGG + Intronic
1083213412 11:61203563-61203585 CAGCAGCAGCAGCCACTTCATGG - Exonic
1083216296 11:61222399-61222421 CAGCAGCAGCAGCCACTTCATGG - Exonic
1083219178 11:61241225-61241247 CAGCAGCAGCAGCCACTTCATGG - Exonic
1083227881 11:61295769-61295791 CAACGGCGCCAGCTGCTTCCTGG - Intergenic
1083258387 11:61510145-61510167 CAGAGGCACCAGCTTCCTCCTGG + Exonic
1083492963 11:63026758-63026780 CAGCTGCTTCAGCTCCTTCAGGG + Intergenic
1084030165 11:66476371-66476393 CTTCAGCACCAGCTCTGTCCTGG + Exonic
1084701707 11:70790570-70790592 TTGCAGCACCAGCTCCTGTCTGG + Intronic
1084937359 11:72594261-72594283 CCGAGTCACCAGCTCCTTCCTGG - Intronic
1085049470 11:73372720-73372742 CGGGGGCACCAGCTTCTTCCAGG - Intergenic
1086425502 11:86678552-86678574 CAGCTTCACTAGCTCCTTCATGG + Intergenic
1086482597 11:87258913-87258935 CAGCAGCAGCAGATACTTCTAGG - Intronic
1086532794 11:87805814-87805836 CTGCAGCATCAACTCTTTCCTGG - Intergenic
1087038061 11:93773768-93773790 CAGGAGCTCCAGGTCCTTGCTGG + Intronic
1087216354 11:95499370-95499392 CAGCAGCACCAGACACTTCTGGG + Intergenic
1087735471 11:101827811-101827833 CCCCAGCAGCAGCTCCCTCCAGG + Intronic
1088619860 11:111671027-111671049 CAGCTGCCCCAGCTCCTCCAGGG - Intronic
1088686478 11:112288464-112288486 CCGCAGGCCCAGCTCCTTCTTGG - Intergenic
1089599162 11:119602928-119602950 CAGCAGCACCGGCTCCACCAGGG - Intergenic
1090034848 11:123239982-123240004 TGGCATCACCAGCTTCTTCCAGG + Intergenic
1090123205 11:124055056-124055078 AAGCTGCACCATCTCTTTCCAGG + Intergenic
1090396846 11:126424747-126424769 CAGCGACAGCAGCTCCTTCCTGG - Exonic
1090406416 11:126478128-126478150 CAGCAAACCCAGCTCCTTCCGGG + Intronic
1090745119 11:129699207-129699229 AAGCAGCACCATCTCTCTCCAGG + Intergenic
1090984862 11:131757178-131757200 CAGTGACTCCAGCTCCTTCCAGG + Intronic
1091270920 11:134311303-134311325 AAGAGCCACCAGCTCCTTCCGGG + Intronic
1091654621 12:2336681-2336703 TAGCAGCACCAGCTCTTCCCTGG - Intronic
1091813202 12:3416830-3416852 CAGCAGCGCAATCTCCATCCAGG - Intronic
1091831247 12:3552608-3552630 CAGGAGAACCAGCCCTTTCCTGG - Intronic
1091974147 12:4811156-4811178 GAGCAGCCCCAGCTCCCTCATGG - Exonic
1092002836 12:5045436-5045458 GAGCAGCCCCAGCTCCCTCATGG - Exonic
1093119659 12:15253560-15253582 TAGCAGCAGCAGCTGCTGCCTGG + Intronic
1094040225 12:26114321-26114343 CAGCTGCACCACACCCTTCCCGG - Intergenic
1094805992 12:34092911-34092933 CCGCAGCACCAAATCCTTACAGG + Intergenic
1095124678 12:38462888-38462910 CTGCAGCACCAAATCCTTACAGG + Intergenic
1095289484 12:40461394-40461416 CAGCAGCATCAGCATCTTCTGGG + Intronic
1096109081 12:49018633-49018655 CACCAGCGCCAGCCCCTGCCCGG + Intronic
1096111836 12:49033459-49033481 CAGCAGCAGCAGCACCTTCTAGG - Exonic
1096220021 12:49823275-49823297 CAGCAGCACCAGGCACTTCCAGG - Intronic
1096537426 12:52284159-52284181 CAGCAGCAGCAGCCCCTGTCAGG - Intronic
1096583165 12:52601347-52601369 CAGCAGCTCCGCCTCATTCCGGG - Exonic
1096626186 12:52897502-52897524 CAGCCGCACCAGCTCCTCCAGGG - Exonic
1096707184 12:53429653-53429675 CAGCAGCACCAACATCATCCTGG - Intronic
1096771678 12:53939434-53939456 CAGCTTCGCCAGCTCCTACCAGG + Exonic
1096870803 12:54590901-54590923 CCCCAGCACCAGCTGCTGCCGGG - Intergenic
1097153172 12:56994491-56994513 CAGCAGTGACAGCTACTTCCCGG + Exonic
1097227684 12:57488192-57488214 CACCAGCACGAGTACCTTCCGGG - Exonic
1098143931 12:67479423-67479445 CTGCAACATCAGCTCCTTCCTGG + Intergenic
1098264759 12:68706978-68707000 CAGCTGCACCAGCTCCACCAGGG + Intronic
1099488411 12:83256137-83256159 CTGCAGCACCAGCTTCTCCCTGG + Intergenic
1100187308 12:92151714-92151736 CAGCAGCATCAGAGTCTTCCTGG + Intergenic
1101133074 12:101709448-101709470 CAGCAGAACAACTTCCTTCCAGG - Intronic
1101407018 12:104437624-104437646 CAGCAGCACCATGTCCTCCAAGG - Intergenic
1101615132 12:106328910-106328932 CAGCAGAGCCGACTCCTTCCCGG - Intronic
1101988226 12:109463952-109463974 AAGCAACACCAACTCCATCCTGG - Intronic
1102011565 12:109622281-109622303 CAGCAGCTGCAGTCCCTTCCTGG - Intergenic
1102442895 12:112977275-112977297 TTGCAGCAGCAACTCCTTCCTGG - Intergenic
1102751764 12:115300787-115300809 CAGCAGCATCAGCACCTCCTGGG - Intergenic
1102751814 12:115301195-115301217 AGGCAGCACCACCTCCTTCTTGG + Intergenic
1102786409 12:115608551-115608573 CTGCTGCAACACCTCCTTCCTGG + Intergenic
1102962379 12:117100910-117100932 CATCAGAATCAGCCCCTTCCTGG + Intergenic
1102977622 12:117217923-117217945 CAGCAGCATCAGCACCATCTGGG - Intronic
1103797343 12:123513452-123513474 CAGCAGCCTCATCACCTTCCTGG + Intronic
1103851524 12:123936633-123936655 GAGCAGCCCCTGCTCCCTCCTGG - Exonic
1103956855 12:124582220-124582242 CAGCAGCAGCAGCACCAGCCTGG - Intergenic
1104316067 12:127702749-127702771 CAGCAGCTGCAGCTCCTGGCAGG - Intergenic
1104387493 12:128363982-128364004 AAGCACCACCAGAGCCTTCCAGG - Intronic
1104691007 12:130826402-130826424 CAGGAGCACCGCCTCCTTGCAGG - Intronic
1104857993 12:131910767-131910789 CAGCAGCTCCACCTCCCACCTGG + Exonic
1105209169 13:18247754-18247776 CAGCAGCAGCAGCACCTTCCTGG + Intergenic
1105392423 13:19992759-19992781 CACCACCACCACCTCCTTTCAGG - Intronic
1105428921 13:20319432-20319454 CTGCAACACCAGCTCCTCACTGG + Intergenic
1106019056 13:25897877-25897899 CAGCTCCATCAGCTCCTTCAAGG + Intronic
1106079430 13:26488095-26488117 CAGGTGGCCCAGCTCCTTCCAGG + Intergenic
1106316211 13:28596314-28596336 CAGCAGGGACAGCTCCTTGCTGG + Intergenic
1112017995 13:95347321-95347343 CAGCAGCACCATCACCATCTGGG - Intergenic
1112442528 13:99434623-99434645 CAGCATAGCCTGCTCCTTCCTGG + Intergenic
1112850520 13:103700361-103700383 CAGCAGAACCTCCGCCTTCCGGG - Intergenic
1113169353 13:107482228-107482250 CTGCAGCATCAGCTCTTTCCTGG + Intronic
1113461629 13:110485983-110486005 CAAGTGCAGCAGCTCCTTCCAGG - Intronic
1113501225 13:110775966-110775988 CAGCAGAGCAAGCTCCTGCCTGG + Intergenic
1113839583 13:113351141-113351163 CAGGATCACCCCCTCCTTCCTGG - Intronic
1114055347 14:18963482-18963504 CAGCGGCACCGCCTCCTGCCCGG - Intergenic
1114107198 14:19438282-19438304 CAGCGGCACCGCCTCCTGCCCGG + Intergenic
1114135747 14:19847688-19847710 CAGCAGCACAATCTCAGTCCCGG - Intergenic
1114182533 14:20378403-20378425 TGGCAGCATCAGCTTCTTCCAGG - Exonic
1114658641 14:24331057-24331079 CATGAGCACCAGCTCCTTAGGGG + Exonic
1115951679 14:38728387-38728409 CAGCTGCACCAGCTCCACCAGGG + Intergenic
1116326843 14:43540949-43540971 CAGCTGCACCAGCTCCACCAGGG - Intergenic
1118930228 14:70234379-70234401 CAGCAGCAGCTGCTCTCTCCGGG - Intergenic
1119193685 14:72701819-72701841 CACCAGCCACAGCTCATTCCCGG + Intronic
1120423918 14:84322987-84323009 CATCACCACCATCCCCTTCCTGG - Intergenic
1121049805 14:90812935-90812957 CAGCAGCATTAGCTCCTTACGGG - Intronic
1121465284 14:94111783-94111805 CCCCAGCACCAGCCCCTCCCAGG - Intronic
1121669084 14:95694254-95694276 CAGCAGAGCCGGCTCCTTTCTGG - Intergenic
1122023128 14:98855854-98855876 CAGCAGCCCCAGGTCCTGCCTGG - Intergenic
1122292908 14:100688920-100688942 CAGAAGCACCCCCTCCCTCCAGG - Intergenic
1122822040 14:104352565-104352587 CAGCAGCACGCCCACCTTCCAGG + Intergenic
1123028410 14:105439381-105439403 TGGCAGCACCAGATCCTTCCTGG + Intronic
1123059298 14:105587255-105587277 CAGCGTCACCAGCTCGTTCAGGG + Intergenic
1123083630 14:105707486-105707508 CAGCGTCACCAGCTCGTTCAGGG + Intergenic
1123222472 14:106870055-106870077 CAGCTGCATCAGCTCCATTCTGG + Intergenic
1123460066 15:20461475-20461497 CAGCAGCACCAACTCATTACAGG - Intergenic
1123480070 15:20622887-20622909 CAGCTTCACAAGCTCCTTCGGGG - Intergenic
1123637937 15:22377477-22377499 CAGCTTCACAAGCTCCTTCGGGG + Intergenic
1123657996 15:22538942-22538964 CAGCAGCACCAACTCATTACAGG + Intergenic
1123689333 15:22823822-22823844 CATCAGCATCTGCTCCTTGCTGG + Exonic
1123706317 15:22953567-22953589 CAGCAGCACCAGGTCTGGCCTGG + Intronic
1124099504 15:26680190-26680212 CTGCAGCATCAGCTCTTTCCAGG + Intronic
1124107803 15:26756888-26756910 CTTCTGCACCAGCTCCTTGCAGG + Intronic
1124266289 15:28237247-28237269 CAGCAGCATCAACTCATTACAGG - Intronic
1124311859 15:28633434-28633456 CAGCAGCATCAACTCATTACAGG + Intergenic
1125840975 15:42801037-42801059 CAGCCACACCAGCTCCTCCAGGG - Intronic
1126467377 15:48973268-48973290 CAGCCGCACCGGCTCCATCAGGG + Intergenic
1127299937 15:57643235-57643257 CACCAGCACCCGCTCCGTGCTGG + Intronic
1127901715 15:63345835-63345857 CAGTGGCACCAGCACCTTCTTGG + Intronic
1128079176 15:64845997-64846019 CAGCACCACCAGCCCCTGCCAGG - Intronic
1128107231 15:65054050-65054072 CAGCAGCATCAGACCCATCCAGG - Exonic
1128191769 15:65707759-65707781 CACCAGCACCACCGCCTCCCAGG + Intronic
1128522945 15:68387399-68387421 CAGCAGCACCAGCACCACCTGGG + Intronic
1128577953 15:68789203-68789225 CAGCAGCCCAAGCTCCCTGCAGG + Intronic
1128615421 15:69105089-69105111 CAGCAGAACGAGCTGCTTCTTGG + Intergenic
1129037764 15:72661310-72661332 CAGCAGCGCCCGCTCCTTTATGG - Exonic
1129212125 15:74075917-74075939 CAGCAGCGCCCGCTCCTTTATGG + Exonic
1129398276 15:75265168-75265190 CAGCAGCGCCCGCTCCTTTATGG - Exonic
1129401886 15:75289443-75289465 CAGCAGCGCCCGCTCCTTTATGG - Exonic
1130133196 15:81160667-81160689 CACCATCTCCAGCTCCTTCTGGG - Intronic
1130841058 15:87701554-87701576 CAGCATCATCAGCCCCTCCCTGG + Intergenic
1130928435 15:88402421-88402443 CAGCAGCAGCAGCTCCACCTGGG - Intergenic
1131047703 15:89326621-89326643 AAGCGGCCCCAGCACCTTCCTGG - Exonic
1131181172 15:90241105-90241127 CAGCTCCACCCGCTGCTTCCAGG - Exonic
1131557066 15:93408819-93408841 CAGCAGCATCACCACCATCCAGG - Intergenic
1131558242 15:93417814-93417836 AAGCAGCAGGGGCTCCTTCCTGG + Intergenic
1132079839 15:98854565-98854587 CTGCATCACCTGCTCCTTTCTGG + Intronic
1132558059 16:581138-581160 CTGCAGGACCAGCTGCCTCCAGG + Intronic
1132761240 16:1509524-1509546 CAGCAGGGCCTGCTCCTTGCTGG - Intronic
1132871032 16:2115837-2115859 CAGAGACACCAGCTCATTCCAGG - Intronic
1133232849 16:4374548-4374570 CGGCCGCCCCAGCCCCTTCCCGG - Intronic
1133448655 16:5884928-5884950 CAGCACCACCAGCTCTTTCCAGG - Intergenic
1133911515 16:10070317-10070339 CAGCAGCATCAGCATCTCCCAGG + Intronic
1134521496 16:14921044-14921066 CAGAGACACCAGCTCATTCCAGG + Intronic
1134612726 16:15622964-15622986 GAGCTGCTGCAGCTCCTTCCGGG + Exonic
1134709167 16:16319695-16319717 CAGAGACACCAGCTCATTCCAGG + Intergenic
1134716376 16:16359724-16359746 CAGAGACACCAGCTCATTCCAGG + Intergenic
1134761522 16:16718951-16718973 CAGCAGCATCAGCACCAGCCTGG + Intergenic
1134950438 16:18348950-18348972 CAGAGACACCAGCTCATTCCAGG - Intergenic
1134958374 16:18392435-18392457 CAGAGACACCAGCTCATTCCAGG - Intergenic
1134984536 16:18640219-18640241 CAGCAGCATCAGCACCAGCCTGG - Intergenic
1135189272 16:20341592-20341614 CAGCAGCATCAGCAGCATCCAGG - Intronic
1136268447 16:29134107-29134129 CAGCATCACTCCCTCCTTCCTGG + Intergenic
1136343869 16:29663113-29663135 CACCATCACCTGCTCCTTCAGGG - Intronic
1136704478 16:32174667-32174689 CAGCAGCATCAACTCATTACAGG - Intergenic
1136763434 16:32754739-32754761 CAGCAGCATCAACTCATTACAGG + Intergenic
1136804666 16:33115647-33115669 CAGCAGCATCAACTCATTACAGG - Intergenic
1137573972 16:49586123-49586145 CAGCATCACCACCTTCTTCCAGG - Intronic
1138002760 16:53299045-53299067 TAGCAGCACCACCTGGTTCCAGG - Intronic
1138451968 16:57098421-57098443 TTGCTGCACCAGCTCCTGCCAGG - Intronic
1138519621 16:57563574-57563596 CACCAGCCCCAGCCCCTGCCAGG - Intronic
1139483928 16:67245939-67245961 CAGCTGCACACGCTTCTTCCAGG + Intronic
1139527346 16:67525085-67525107 CAGCCTCAGCTGCTCCTTCCAGG + Intronic
1139964609 16:70738503-70738525 CTGCAGCAATAGCTCTTTCCCGG - Intronic
1140380173 16:74479721-74479743 CGGCAGCATCGGCTGCTTCCCGG - Intronic
1141470808 16:84237122-84237144 CAGGAGCCCCAGCGCCTTCGGGG - Exonic
1141621409 16:85238414-85238436 CTGCAGCACCAGCCCCCACCAGG - Intergenic
1141661843 16:85445707-85445729 CAGCAGCAGCAGCCCTCTCCTGG + Intergenic
1142033131 16:87848325-87848347 CAGCAGCAGCACGTCCCTCCTGG - Intronic
1142064704 16:88054596-88054618 CACCAGCACCAGCACCGTCAAGG + Intronic
1142071757 16:88094444-88094466 CAGCAACACTCCCTCCTTCCTGG + Intronic
1142109002 16:88321265-88321287 CTGCAGCATCAGCTCCTGCCTGG - Intergenic
1142185714 16:88693876-88693898 CAGGAGCCCCAGCTCCTCCAGGG + Intergenic
1142278724 16:89137084-89137106 CAGCAGCAGCAGCCCCTCCTGGG + Intronic
1142289608 16:89187547-89187569 CAGCAGCAGCACCTCATCCCTGG - Exonic
1203065584 16_KI270728v1_random:1015060-1015082 CAGCAGCATCAACTCATTACAGG + Intergenic
1143095322 17:4475720-4475742 CTGCAGTCCCAGGTCCTTCCTGG - Intronic
1143118102 17:4591931-4591953 CAGTGGCACCAGGTCCTTCTGGG - Intronic
1143164384 17:4890643-4890665 CAGCAGCAGCAGCTCCTGCCTGG + Exonic
1143323314 17:6081849-6081871 CAGCAGCATCAGCTCCGCCTGGG + Intronic
1143579521 17:7817494-7817516 CAGCAGCCCCCGCGCCTTCACGG - Intronic
1143978146 17:10845241-10845263 ACTCAGCCCCAGCTCCTTCCTGG - Intergenic
1144185204 17:12790003-12790025 CCCCTGCACCAGCTCCCTCCAGG + Intronic
1144404896 17:14942701-14942723 AAGCAGCACCAGGGCCCTCCAGG - Intergenic
1144583768 17:16475423-16475445 CAGCACTGCCAGCTCCTTCCTGG - Intronic
1144727525 17:17509368-17509390 GAGCTGCACCAGCTCCTCTCCGG + Intronic
1145040880 17:19577453-19577475 CCGCAGCACCAGCTGTTTCCTGG - Exonic
1145809467 17:27755882-27755904 CAGTGGCACCAGCTGCATCCGGG + Intergenic
1146602976 17:34234716-34234738 CAGCAGGACTGGCTTCTTCCCGG + Intergenic
1147176449 17:38658959-38658981 CAGCAGCAGCACCTCCTCTCTGG - Intergenic
1147743840 17:42683325-42683347 CAGGGGCACCAGCTCCTGCTTGG - Intronic
1147925141 17:43941358-43941380 CCCCAGCCCCAGCCCCTTCCAGG - Intronic
1148044092 17:44731901-44731923 CAGAAGCATCTGTTCCTTCCTGG + Intronic
1148189777 17:45670554-45670576 AAGCAGCATCCCCTCCTTCCTGG + Intergenic
1148388368 17:47252971-47252993 CTGCACTACCAGCTACTTCCTGG + Intergenic
1149664611 17:58357217-58357239 CAGCCACACCAGCACCTCCCTGG + Intronic
1149995596 17:61404602-61404624 CGGCAGCGTCAGCTGCTTCCTGG - Exonic
1150652691 17:67020115-67020137 CAACAGCCGCAGCTCCTGCCAGG - Intronic
1151016467 17:70559876-70559898 AAGCAACACCAGCAACTTCCAGG + Intergenic
1151202411 17:72478304-72478326 CAGCAGCAGCAGCGCTTTCATGG + Intergenic
1151497318 17:74466652-74466674 CAGCAGCTCCAGGCCCTACCTGG - Exonic
1151542810 17:74773440-74773462 CAGGAGTTCCAGCACCTTCCAGG + Intronic
1151734594 17:75931228-75931250 CCTCAGCATCAGCTTCTTCCAGG + Exonic
1152222218 17:79075080-79075102 CCGCAGCCCCACCTCCTTCCCGG - Exonic
1152528784 17:80904678-80904700 AGGCAGCCCCACCTCCTTCCTGG + Intronic
1152593888 17:81229041-81229063 CAGCAGCCCCAGCCCCCACCAGG + Exonic
1152928212 17:83097606-83097628 CTGCACCCCCAGCTCCTTCCTGG + Intergenic
1153448136 18:5196715-5196737 CAGCAGCACCGGCACCTACACGG - Intronic
1153555697 18:6311010-6311032 CTGCAGCACCAACTCCTCCCTGG + Intronic
1153647304 18:7206751-7206773 ATGGAGGACCAGCTCCTTCCTGG + Intergenic
1153824747 18:8865120-8865142 GAAAGGCACCAGCTCCTTCCTGG - Intergenic
1153961938 18:10147511-10147533 GAGCAGCTCCAGCTCCTCCATGG + Intergenic
1154203163 18:12314061-12314083 CAGCAGCCACAGCTTCTTTCTGG + Intronic
1155341294 18:24817098-24817120 TAGCAGCATCAGCACCCTCCTGG - Intergenic
1155498835 18:26467391-26467413 CTGCAGCCCCAGCTACTTCGGGG + Intronic
1155591100 18:27428469-27428491 CAGCATCACTGGCTCCTTCTCGG - Intergenic
1155627345 18:27849851-27849873 CAGCAGCAGCAGCACCTCTCAGG - Intergenic
1156371215 18:36473107-36473129 CAGCACCACCAGCTTCTCCTGGG + Intronic
1157769964 18:50337293-50337315 TACAAGCACCAGCCCCTTCCAGG - Intergenic
1158426620 18:57346287-57346309 CAGCAACAGCAGCTGCTTCTTGG + Intergenic
1159020926 18:63142451-63142473 CAACAGAACCAGCACCATCCGGG - Intronic
1159778530 18:72632831-72632853 CAGCAGAACCAGCTCTTTGGGGG - Intronic
1160057681 18:75499998-75500020 CAGCAGCAGCAGCAGCATCCAGG + Intergenic
1160424439 18:78770503-78770525 CAGGGCCACCAGCTCCTCCCTGG + Intergenic
1160709067 19:542472-542494 CGGCGGCTCCAGCTCCGTCCAGG + Intergenic
1161119898 19:2519772-2519794 CTGCAGCACCAACTCTTCCCTGG + Intronic
1161136386 19:2622487-2622509 TGGCAACACCAGCTGCTTCCGGG + Intronic
1161412403 19:4123846-4123868 CGGCAGCACCGGCTTCCTCCGGG + Exonic
1161459021 19:4385546-4385568 CAGCAGCACTCTTTCCTTCCGGG + Intronic
1161845683 19:6710774-6710796 CAGCACCACCAGGTCCTGGCCGG + Exonic
1162113264 19:8413051-8413073 CAGCAGCACCCCCTCGTGCCTGG + Intronic
1163828150 19:19535272-19535294 CACCAGCACCAGACCCTGCCTGG - Intronic
1164562147 19:29299753-29299775 GAGCACCAACAGCTCCCTCCTGG - Intergenic
1164712536 19:30367671-30367693 CAGCATCACCAGCACTTCCCAGG - Intronic
1166599429 19:44081052-44081074 CAGCAGCCCCAGCTCCTCCTCGG - Exonic
1166617759 19:44266235-44266257 CAGCAACCCCAGCTCCTCCCTGG - Exonic
1166650523 19:44570994-44571016 CAACAGCAGCAGCTCCTTCCAGG + Intergenic
1166864884 19:45829862-45829884 CAGTAGCAGCAGCTCCTCCTGGG - Intronic
1167161272 19:47768835-47768857 CAGCAGCAACTGCGCCTGCCTGG - Intergenic
1167166455 19:47802907-47802929 CAGCAGCCCCAGCGCGTCCCTGG - Exonic
1167175388 19:47860853-47860875 CAGCAGCCCCAGCGCGTCCCTGG + Intergenic
1167288652 19:48612929-48612951 CAGCCGCACCAGCTCCTTGAGGG + Exonic
1167311512 19:48740178-48740200 CAGCTTCGCCAGCTGCTTCCTGG + Exonic
1167522047 19:49960958-49960980 CGGCAGCCCCAGCCCCTGCCTGG + Intronic
1167523335 19:49969767-49969789 CGGCAGCCCCAGCCCCTGCCTGG - Intergenic
1167621334 19:50562663-50562685 CAGCAGCCCCAGCCACTCCCAGG - Intronic
1167807731 19:51800159-51800181 CAGCAGCACCGGCTCTTGCAAGG - Intronic
1168291433 19:55359518-55359540 CAGCTGCGTCAGCTCCTCCCCGG - Exonic
1168294640 19:55372838-55372860 CCCCAGCACCAGCTCCTGCTGGG + Intergenic
925388739 2:3481740-3481762 CAGCAGCACCAGGTTCTCCTGGG + Intronic
925415661 2:3668489-3668511 CACCAGCACCGTCTCCCTCCTGG - Intronic
925561678 2:5203018-5203040 AAACAGCAACATCTCCTTCCTGG + Intergenic
929771917 2:44899416-44899438 CAGAAGCAGCAGCTCCTTGGTGG + Intergenic
929946835 2:46378066-46378088 CAGCAGCAGCAGCTGCTCCACGG + Exonic
930611868 2:53553648-53553670 CAGGGGCTCCAGGTCCTTCCTGG - Intronic
930935080 2:56939148-56939170 CTGCAGCCTCAGCTCTTTCCTGG - Intergenic
932107205 2:68954963-68954985 CGTCAGCACCAGGCCCTTCCAGG - Intergenic
932289070 2:70559923-70559945 CAGCCACACAAGCTCCTTGCTGG + Intergenic
932828955 2:74969629-74969651 AAGCAGCAGCAGCTGCATCCAGG - Exonic
933190204 2:79325679-79325701 CAGCATCACCTTCTCCATCCAGG + Intronic
933745823 2:85570629-85570651 CAGCAGCACGATCTCTTCCCTGG - Intronic
933796138 2:85921308-85921330 CAGCAGCAGCAGCAGGTTCCTGG - Intergenic
933834357 2:86233124-86233146 CTGCAGCTCCTACTCCTTCCAGG + Intronic
934034568 2:88078109-88078131 CCCCAGCACCAGCTCATTCCAGG - Intronic
934779346 2:96959942-96959964 CATCAGCACTGGCCCCTTCCTGG - Intronic
936444005 2:112581864-112581886 TGGCAGCACCAACTCCTGCCTGG + Intergenic
936458299 2:112692500-112692522 CAGCAGCCCCACCTCCTTCCAGG + Intergenic
937473687 2:122195261-122195283 CACCTGCACCACCTTCTTCCAGG - Intergenic
937496779 2:122428882-122428904 CAGCACCACAATCCCCTTCCTGG - Intergenic
937811192 2:126201185-126201207 CAGCAGTACCAGCTCTTCCAGGG - Intergenic
937901767 2:127025227-127025249 CAGCAGAACCCGCTGCCTCCAGG + Intergenic
938237450 2:129717628-129717650 CAGTAGCCACAGCTCCTGCCAGG + Intergenic
938296472 2:130182344-130182366 CCGCAGCGCCAGCTTCTGCCGGG - Exonic
938337431 2:130511933-130511955 CAGCACTCCCTGCTCCTTCCTGG + Intergenic
938352407 2:130608802-130608824 CAGCACTCCCTGCTCCTTCCTGG - Intergenic
938460279 2:131492293-131492315 CCGCAGCGCCAGCTTCTGCCGGG + Exonic
938670518 2:133582192-133582214 CTGCAGCACCAGCACCATGCAGG + Intergenic
940064412 2:149611127-149611149 CAGAAGCTGCACCTCCTTCCAGG - Intergenic
941344513 2:164350913-164350935 CAGTAGCAACAGCACCTTACAGG + Intergenic
942150962 2:173075809-173075831 CAACAGCACCACCTACCTCCCGG - Intronic
942364363 2:175208000-175208022 CAGCAGCACCAGCACCATGTAGG - Intergenic
942481569 2:176393744-176393766 CAGCACCACCAGCTCCTGCTGGG + Intergenic
942571064 2:177314898-177314920 CAGCAGCATCAGCACTTACCTGG + Intronic
943435918 2:187866320-187866342 GACCAAAACCAGCTCCTTCCCGG - Intergenic
943436015 2:187866846-187866868 GAGCAGCACCAGCTTCTCCCTGG + Intergenic
943436022 2:187866902-187866924 GAGCAGCACCAGCTTCTCCCTGG + Intergenic
943436324 2:187869058-187869080 GAACAGCACCAGCTCCTCTCTGG + Intergenic
943731662 2:191308836-191308858 CAACATGACCAGCTCCTTCCTGG + Intronic
944128283 2:196318642-196318664 CAGCAGCTGCAGCTCCCTCCAGG + Exonic
944353778 2:198760828-198760850 CAGCAGCACCAGCAAATTCTGGG + Intergenic
944772241 2:202926005-202926027 CAGCTGCACCAGCTCCTTCAGGG + Intronic
946320823 2:218953479-218953501 CAGCTGCACCAGCTCCACCAGGG - Intergenic
946466967 2:219920621-219920643 CAGCAGCATCAGCGTCTTCTGGG - Intergenic
947633979 2:231671004-231671026 CAGAGGCCCCAGTTCCTTCCTGG - Intergenic
947861090 2:233357859-233357881 CAGCAGCATCAGCATCTTCTGGG - Intronic
948301284 2:236909228-236909250 CGGCAGCACCATCTCCTCCCTGG - Intergenic
948663314 2:239519914-239519936 CTGCAGCCCCAGCACCTTCATGG - Intergenic
948701002 2:239760269-239760291 CCGCAGGAGAAGCTCCTTCCCGG + Intergenic
949024620 2:241760784-241760806 CTGCAGCACCAGCTCCTGCTGGG + Intronic
949070298 2:242020425-242020447 TGGCAGCACCAGCTCCTCCGTGG - Intergenic
949070843 2:242023125-242023147 CAGGAACATCAGCTCCTCCCCGG - Intergenic
949071133 2:242024955-242024977 CTGGAACATCAGCTCCTTCCTGG - Intergenic
949071144 2:242025001-242025023 CAGAAGAACCAGCTCCTCCCTGG - Intergenic
949071169 2:242025162-242025184 CAGCAACACCAGCTCCTCCGCGG - Intergenic
949071197 2:242025315-242025337 CAGCAGCACCAGCTCATCCGTGG - Intergenic
949073896 2:242042908-242042930 CAGCCGCACCTGCTCCGTCCTGG - Intergenic
1168768139 20:396194-396216 CTCCAGCACCAGCTTCTTCCTGG - Exonic
1168808468 20:687126-687148 CAGCAGCACGAGCTCTGTCTTGG + Intergenic
1169190082 20:3653242-3653264 CATCTGCACCCGCTCCTTCCTGG + Intergenic
1169270885 20:4198581-4198603 CAGCAGCATCAGCATCTCCCGGG + Intergenic
1169738450 20:8863570-8863592 CAGCAGCATCAGCTTCATCTGGG - Intronic
1169748695 20:8969230-8969252 CAGCAGAACCAGTTCCTACTTGG - Intergenic
1170477116 20:16726414-16726436 CAGCAGCATCAGCATCATCCGGG + Intergenic
1170643316 20:18175302-18175324 GAGCAGCACTAGAGCCTTCCTGG - Intronic
1171009448 20:21500591-21500613 CAGCAGCACCAGCGTCTCCCTGG + Intergenic
1171070928 20:22067890-22067912 CAGCAGCATCAGCACCATCTGGG - Intergenic
1171173797 20:23036479-23036501 CAGCACCTCCAGCACCTTCCAGG - Exonic
1171290343 20:23979467-23979489 CAGCGGCAGCAGCACCTTCCTGG + Intergenic
1171419866 20:25010851-25010873 CAGCAGCACCAGAGGCTTGCTGG + Intronic
1171540025 20:25942951-25942973 CCACAGCACCAGCTCTTTCTAGG + Intergenic
1171801038 20:29617370-29617392 CCACAGCACCAGCTCTTTCTAGG - Intergenic
1172115392 20:32570587-32570609 AAGCAGCAGCAGCTACTTCCTGG + Intronic
1172311077 20:33918879-33918901 CGGCTGCACCAGCCCCTCCCTGG + Intergenic
1172613897 20:36271176-36271198 ATGCAGCACAAGCTCCTGCCTGG - Intergenic
1173572673 20:44087642-44087664 CAGCAGCAGCAGCTACGTGCAGG - Intergenic
1173729299 20:45317468-45317490 CTGGAGCACCAGGTCCTTCCTGG + Exonic
1174060907 20:47832532-47832554 CTGCAGCACCAGCTCCGCCCCGG + Intergenic
1174060917 20:47832585-47832607 CAGCAGCACCAGCTCCCCTGTGG + Intergenic
1174060938 20:47832690-47832712 AAGCAGCACCGGCTACTCCCTGG + Intergenic
1174061023 20:47833218-47833240 CAGCAGCTCCGACTCCTCCCTGG + Intergenic
1174061040 20:47833324-47833346 CAGCAACACCGGTTCCTCCCTGG + Intergenic
1174061079 20:47833547-47833569 CAGCAGCACTGACTCCTCCCCGG - Intergenic
1174061089 20:47833600-47833622 CAGCAGCACCGGCTCCACCCTGG - Intergenic
1174061099 20:47833654-47833676 CAGCAGCAGCAGCTCCTCCCGGG - Intergenic
1174061220 20:47834294-47834316 CAGCAGCACCAGCTCTTACCTGG + Intergenic
1174061263 20:47834606-47834628 AGGCAGCACCAGCTCCTCCGTGG + Intergenic
1174061277 20:47834703-47834725 CAGCAGCACCATCTTCTCCCTGG + Intergenic
1174070250 20:47894620-47894642 CAGCAGCACCATCTTCTCCCTGG - Intergenic
1174070255 20:47894673-47894695 CGGCAGCACCAGCTCCTTTCTGG - Intergenic
1174070513 20:47896093-47896115 AGGCAGCACCAGCTCCTCCGTGG - Intergenic
1174070556 20:47896405-47896427 CAGCAGCACCAGCTCTTACCTGG - Intergenic
1174070667 20:47896991-47897013 GAGCAGCAGCAGCTCCTCCCGGG + Intergenic
1174070677 20:47897045-47897067 CAGCAGCAGCAGCTCCTCCCGGG + Intergenic
1174070687 20:47897099-47897121 CAGCAGCACCGGCTCCACCCTGG + Intergenic
1174070697 20:47897152-47897174 CAGCAGCACTGACTCCTCCCCGG + Intergenic
1174070735 20:47897375-47897397 CAGCAACACCGGTTCCTCCCTGG - Intergenic
1174070857 20:47898043-47898065 CAGCAACACCAGTTCCTCCCTGG - Intergenic
1174070874 20:47898152-47898174 CAGCAGCTCCGACTCCTCCCTGG - Intergenic
1174070959 20:47898680-47898702 AAGCAGCACCGGCTACTCCCTGG - Intergenic
1174070981 20:47898785-47898807 CAGCAGCACCAGCTCCCCTGTGG - Intergenic
1174070991 20:47898838-47898860 CTGCAGCACCAGCTCCGCCCCGG - Intergenic
1174100124 20:48120997-48121019 CAGCAGCACCAGCTCCCCTGGGG + Intergenic
1174100141 20:48121102-48121124 CAGCAGCACCAGCTACTCCCTGG + Intergenic
1174100235 20:48121632-48121654 CAGCAGCACCAGCTCCCCTCTGG + Intergenic
1174100244 20:48121685-48121707 CAGCAGCACAGGCTCCTCCTTGG + Intergenic
1174100275 20:48121892-48121914 CAGCAGCACTGGCCCCTCCCCGG + Intergenic
1174100358 20:48122301-48122323 CAGCAGCACCGGCTCCTCCTTGG + Intergenic
1174100402 20:48122577-48122599 CAGCAGCACTGACTCCTCCCCGG - Intergenic
1174100412 20:48122630-48122652 CAGCAGCACCGGCTCCACCCTGG - Intergenic
1174100422 20:48122684-48122706 CAGCAGCAGCAGCTCCTCCCGGG - Intergenic
1174100432 20:48122738-48122760 CAGCAGCAGCAGCTCCTCCCGGG - Intergenic
1174100563 20:48123473-48123495 CAGCAGCACCAGCTCCTCCCTGG + Intergenic
1174100635 20:48123892-48123914 GAGGAGCACCGGCTCCTCCCTGG + Intergenic
1174100708 20:48124296-48124318 CTGCAGCACCAGCTCGTCCAAGG + Intergenic
1174101051 20:48126426-48126448 CAGCAGCACCAGCTCCTTCCTGG + Intergenic
1174148862 20:48472032-48472054 CAGCGGCACCAGCTCCTCCCTGG + Intergenic
1174148919 20:48472398-48472420 CAGCACCACCCGCTCCTCCGGGG + Intergenic
1174148936 20:48472555-48472577 CGGCAGCACCCGCTCCTCCCCGG + Intergenic
1174148955 20:48472661-48472683 CAGCAGTACCCGCTCCTCCCCGG + Intergenic
1174148972 20:48472767-48472789 CTGCAGCACCTGCTCCTCCCCGG + Intergenic
1174148999 20:48472925-48472947 CAGCAGCACCAGCTCCTCCTTGG + Intergenic
1174149019 20:48473078-48473100 CAGCAGCACCATCTCCTCTCTGG + Intergenic
1174149026 20:48473131-48473153 CTGCAGCACCTGCTCCTCCCTGG + Intergenic
1174149045 20:48473236-48473258 CAGCAGCACCATCTCCTCTCTGG + Intergenic
1174149062 20:48473342-48473364 CAGCAGCACCAGCTCCTCCTTGG + Intergenic
1174149083 20:48473487-48473509 CAGCAGCACCATCTCCTCTCTGG + Intergenic
1174149201 20:48474265-48474287 CTGCAGCACCACCTCCTCCCTGG + Intergenic
1174149217 20:48474369-48474391 CTCCAGCACCAGCTCCTTCCTGG + Intergenic
1174149324 20:48475056-48475078 CAGCAGCACCAGCTCCTCCCTGG + Intergenic
1174149449 20:48475884-48475906 CCGCAGCAACAGCTCCACCCAGG + Intergenic
1174149473 20:48476035-48476057 CTGCAGTACCAGCTCCTTCCCGG + Intergenic
1174149492 20:48476141-48476163 AAGCAGCACCAGCTCCTCCCTGG + Intergenic
1174149504 20:48476194-48476216 CTGCAGCACTGGCTCCTCCCCGG + Intergenic
1174149530 20:48476353-48476375 CAGCAGTGCCAACTCCTTTCTGG + Intergenic
1174149547 20:48476459-48476481 CAGCAGCACCGGCTCCTCCCTGG + Intergenic
1174149572 20:48476576-48476598 CGGTAGCACCAGCTCCTCCCCGG - Intergenic
1174149599 20:48476752-48476774 CAGCAGCACCAGCTCCTTTCTGG + Intergenic
1174149625 20:48476910-48476932 CAGCAGCACCGGTTCCTTTCTGG + Intergenic
1174149650 20:48477066-48477088 CGGCAGCGCCGGCTCCTCCCTGG + Intergenic
1174153067 20:48499820-48499842 CTGCAGCACCAGCTCCGCCCCGG + Intergenic
1174153077 20:48499873-48499895 CAGCAGCACCAGCTCCCCTGTGG + Intergenic
1174153098 20:48499979-48500001 CAGCAGCACCGGCTACCCCCTGG + Intergenic
1174153189 20:48500507-48500529 CAGCAGCACCGGCTCCTCCCTGG + Intergenic
1174153198 20:48500560-48500582 CAATAGCACCGGCTCCTCCCTGG + Intergenic
1174153328 20:48501281-48501303 CAGCAACACCGGTTCCTCCCTGG + Intergenic
1174153372 20:48501557-48501579 CAGCAGCACCGGCTCCACCCTGG - Intergenic
1174153382 20:48501611-48501633 CAGCAGCAGCAGCTCCTCCCGGG - Intergenic
1174153437 20:48501899-48501921 TGGCATCACCAGCTCCTCCCTGG + Intergenic
1174153527 20:48502406-48502428 CAGCAGCATCAGCTCCTCCCTGG + Intergenic
1174153601 20:48502862-48502884 CAGCAGCACCAGCTCCTTTCTGG + Intergenic
1174153624 20:48503021-48503043 AGGCAGCACCAGCTCCTCCGTGG + Intergenic
1174156122 20:48516444-48516466 CAGCAGCACCAGCTGCTTCCTGG + Intergenic
1174156139 20:48516553-48516575 CGGCAGCACCAGCTCCTTTCTGG + Intergenic
1174156144 20:48516606-48516628 CAGCAGCACCATCTTCTCCCTGG + Intergenic
1174386112 20:50189543-50189565 CAGCAGCAAAAGCATCTTCCTGG + Intergenic
1174530527 20:51209264-51209286 CAGCAGCATCAGCTTCACCCTGG + Intergenic
1175410290 20:58763235-58763257 CATCAGCACCGGCCCCTCCCTGG + Intergenic
1175496590 20:59418692-59418714 CAGCAGCAGCAGCTCTCACCAGG + Intergenic
1175573267 20:60040117-60040139 CAGCAGCACCAGCATTCTCCGGG + Intergenic
1175696920 20:61109500-61109522 CCGAAGAACCAGCTCCTTCCTGG + Intergenic
1176105631 20:63384527-63384549 CAGCTGCTGCAGCTTCTTCCTGG + Intergenic
1176119270 20:63446690-63446712 AGGCAGCTCCAGCTCCTTCCTGG + Intronic
1176121878 20:63457744-63457766 CAGCAACCACAGGTCCTTCCAGG + Intronic
1176160082 20:63643213-63643235 CAGAGGCTCCTGCTCCTTCCAGG + Intronic
1176244381 20:64090565-64090587 CTGAATCACCAGCTCCCTCCCGG - Intronic
1177151345 21:17458468-17458490 CTGCAGCATCAACTCTTTCCTGG - Intergenic
1178399814 21:32275855-32275877 CACCAGCACCACCTCTTGCCTGG + Intronic
1178409987 21:32355512-32355534 CCAGAGCTCCAGCTCCTTCCAGG + Exonic
1178704869 21:34864725-34864747 CAGCAGCATCAGTTCCAGCCAGG + Intronic
1179173157 21:38988676-38988698 CTGCAACACCGCCTCCTTCCAGG - Intergenic
1179347185 21:40569498-40569520 CTGCGGCATCAGCTCCTGCCTGG + Intronic
1179632892 21:42689425-42689447 CCTCAGCACCAGCTCCAGCCTGG + Intronic
1179727709 21:43349541-43349563 CAGCAGGACCAGCTCCTAGTGGG - Intergenic
1179887165 21:44319099-44319121 CAGCAGCTCCAGCTCCAGGCAGG - Intronic
1180188105 21:46150360-46150382 CAGCAGCAGCGGCTGCTCCCGGG + Intronic
1180473827 22:15686034-15686056 CAGCGGCACCGCCTCCTGCCCGG - Intergenic
1180606330 22:17061688-17061710 CCCCAGCACCTGCTCCTGCCTGG + Intergenic
1180767086 22:18351543-18351565 CAGCGGCAGCAGCACCTTCCTGG - Intergenic
1180779225 22:18510836-18510858 CAGTGGCAGCAGCACCTTCCTGG + Intergenic
1180786292 22:18549594-18549616 CAGCAGCACCAGCTTCTACAAGG + Intergenic
1180811944 22:18768156-18768178 CAGCGGCAGCAGCACCTTCCTGG + Intergenic
1180948573 22:19710121-19710143 CAGCAGCATCAGCTCCTGCTGGG - Intergenic
1181131574 22:20735321-20735343 CAGCAGCACCAGCTTCTACAAGG + Intronic
1181198099 22:21202400-21202422 CAGCGGCAGCAGCACCTTCCTGG + Intergenic
1181243214 22:21489148-21489170 CAGCAGCACCAGCTTCTACAAGG + Intergenic
1181401645 22:22653404-22653426 CAGCGGCAGCAGCACCTTCCTGG - Intergenic
1181438618 22:22924368-22924390 CAGCAGGGCCGGCTCCTTCTGGG + Intergenic
1181500984 22:23315425-23315447 CAGCAGCACCTGGACCTGCCCGG - Exonic
1181527546 22:23498900-23498922 AAGCACCCCCTGCTCCTTCCAGG - Intergenic
1181703603 22:24634501-24634523 CAGCGGCAGCAGCACCTTCCTGG - Intergenic
1181810511 22:25401072-25401094 ATGCAGCCCCAGCTCCTGCCAGG + Intronic
1182585265 22:31341282-31341304 CAGCATGCCCAGCTCCTCCCTGG - Intronic
1182714733 22:32348424-32348446 CAGCAGCAGCTGCTCCTCCAGGG + Intergenic
1182788062 22:32924487-32924509 CAGCAGCATCAGCAGCATCCAGG + Intronic
1183239908 22:36650029-36650051 CACCACCACCAACTCCTGCCTGG + Intronic
1183254123 22:36750003-36750025 CAGTAGAACCAGCTCTTTCTTGG + Intergenic
1183354258 22:37350008-37350030 CAGCAGCACCTGGTCCTGGCGGG + Intergenic
1183700137 22:39446395-39446417 GAGCAGGCCCAGCTCATTCCCGG - Intergenic
1183748168 22:39704173-39704195 CAGGACCCCCAGCTCCCTCCTGG - Intergenic
1183945085 22:41320863-41320885 CAGCCACACCAGCCCCTTCCTGG - Intronic
1184094241 22:42308062-42308084 TAACAGCACAGGCTCCTTCCAGG + Intronic
1184274706 22:43403783-43403805 CAGCACCCTCAGCTCCCTCCTGG - Intergenic
1184295535 22:43521838-43521860 CAGCAGCAACAAATCCTTCAGGG - Intergenic
1184327279 22:43798387-43798409 CAGCAGCACCAGCATCTCCTGGG - Intronic
1184342182 22:43891995-43892017 CACCAGCACCAGCCCCAGCCCGG - Exonic
1184690069 22:46113531-46113553 CAGCAGCAGCTGCCCCTTCCTGG + Intronic
1184755703 22:46514682-46514704 CTGCAGCCCCGGCTCCCTCCGGG - Intronic
1185045314 22:48525681-48525703 CAGCAGCAGCAGCAGCTTCTGGG - Intronic
1185324051 22:50216990-50217012 CAGCGTCCCCAGCGCCTTCCAGG - Exonic
1185377787 22:50490027-50490049 CAGAAGCACAACATCCTTCCAGG - Exonic
1203228708 22_KI270731v1_random:92437-92459 CAGCGGCAGCAGCACCTTCCTGG - Intergenic
949158899 3:857924-857946 CCGCAGCACCAACTCTTCCCTGG + Intergenic
949158954 3:858284-858306 TCGCAGCACCAGCTCTTCCCCGG + Intergenic
949159112 3:859340-859362 CCGCAGCACCAGCTCTTCCCCGG + Intergenic
949219059 3:1607604-1607626 CAGCAGCACCAGTACCAACCTGG - Intergenic
949248921 3:1959201-1959223 CAGCTCCTCCAGCTCCTCCCAGG - Intergenic
949517385 3:4820012-4820034 CAGAATCACCAGCACCCTCCCGG - Intronic
950304648 3:11908508-11908530 CAGCAGCACCAGCTTCTTGCTGG - Intergenic
950316379 3:12004880-12004902 CAGCAGCACCTTGGCCTTCCTGG - Exonic
950494635 3:13326257-13326279 CAGCAGCACCAGACCATTCCTGG - Intronic
950721880 3:14889058-14889080 TAGCTGCACCAGCTCCTGCAGGG + Intronic
950941894 3:16901322-16901344 CATCAGCACCAGCTCCCCACTGG - Intronic
950985757 3:17364021-17364043 CAGCACCACCACCCCCTCCCCGG + Intronic
952611484 3:35215776-35215798 CAGCCGCACCAGCTCCACCAGGG - Intergenic
952953277 3:38541588-38541610 CAGCAACACCGACTCCTTACAGG - Intronic
953432640 3:42852378-42852400 CTGCAGCAGCAGCTCCTTGAAGG + Intronic
953576633 3:44117881-44117903 CAGCAGCACCAGCATCTCCTGGG + Intergenic
953691528 3:45124051-45124073 CTGCCTCACCAGCTCCTTCCTGG + Intronic
954682748 3:52354792-52354814 CATCAGGACCAGCCCCTCCCAGG + Intronic
954871281 3:53769258-53769280 CAGCAGCTCCACCTCCTCCAGGG - Intronic
958562089 3:95759816-95759838 CAGCCGCCTCAGCTCCCTCCAGG - Intergenic
959917593 3:111835445-111835467 CCCCAGCAGCAGCTCCTTCCAGG + Intronic
960372089 3:116853024-116853046 CTGCAGCATCAGCTCCTCCCTGG + Intronic
960677948 3:120215179-120215201 CAGCTGCAGCAGCACCATCCAGG + Intronic
960739424 3:120816779-120816801 TTGCAGCACCAGCTCCTGGCAGG - Intergenic
961986163 3:131137436-131137458 CAGCTTCATCAGCTCCCTCCTGG + Intronic
962637838 3:137349115-137349137 GAGCAGCAGCAGCTGCTGCCTGG + Intergenic
962712759 3:138101555-138101577 CAGCCGCACCAGCTCCACCAGGG - Intronic
963430008 3:145188614-145188636 CAGCAGCACCAGCAGCATCTGGG + Intergenic
964036968 3:152210887-152210909 CTGCAGCATCAGCTCTTTCCTGG + Intergenic
966372079 3:179261130-179261152 CTGCCGCTCCAGCTCCTTCATGG + Intronic
966473328 3:180317125-180317147 AAGCAGCTCCAGCTGCTTCCTGG + Intergenic
966861572 3:184233573-184233595 CAGCCCCACCAGCTGCTTCGGGG + Exonic
967201116 3:187073478-187073500 CTGCAACAGCAGCTCTTTCCGGG + Intronic
967485283 3:190023155-190023177 CAGCAGCACCAGCTTCACCTGGG - Intronic
967511223 3:190314952-190314974 AAGCAGCTTCAGTTCCTTCCTGG - Intronic
968019014 3:195367263-195367285 CAGCAGCATCAGCACCATCTGGG - Intronic
968106420 3:196004860-196004882 TGGCAGCACCGGCTCCTCCCTGG + Intergenic
968222311 3:196948111-196948133 GAGCAGCACCAGGGCCTCCCGGG + Exonic
968490566 4:888695-888717 CAGCATCACCCGCTTCTCCCAGG - Intronic
968502625 4:958115-958137 CAGCTGCACCATCATCTTCCTGG + Exonic
968509414 4:988794-988816 CAGCAGCCTCTGCTCCCTCCTGG - Exonic
968522075 4:1038534-1038556 CAGCAGCCCCACCTGCTCCCAGG + Intergenic
968764003 4:2458775-2458797 CTGCTCCACCAGCTCCTTCCTGG - Exonic
969289470 4:6229485-6229507 CAGCATTATCAGCTCCTGCCAGG - Intergenic
970307128 4:14744578-14744600 CAGCAGCACTAGCTCCCACCAGG + Intergenic
970927595 4:21470972-21470994 CAGCAGCATCAGCATCTTCTAGG + Intronic
971083137 4:23238899-23238921 CAGCACCACCACCTCTATCCTGG - Intergenic
971197446 4:24482992-24483014 CAGCAGCAGCAGCAGCCTCCAGG - Intergenic
971228055 4:24773235-24773257 GTGCAGCATCAGCTCCTCCCTGG + Intergenic
971954632 4:33400591-33400613 CAGCCGCACCAGCTCCACCAGGG + Intergenic
972612157 4:40665962-40665984 CAGCAGCACCAATTAATTCCTGG - Intergenic
972926583 4:44016019-44016041 TAGCAGCACCACCTCACTCCAGG + Intergenic
974478030 4:62407849-62407871 CAACAGGACTAGCTCTTTCCTGG - Intergenic
977170462 4:93755228-93755250 CAGCAGCACCAACTGCTTATAGG - Intronic
977536574 4:98261416-98261438 CAGCACCAGCTGCTCCTCCCCGG + Intronic
978337983 4:107690055-107690077 CCGTAGCACCAGCTCCTTCAGGG - Intronic
982080192 4:151782076-151782098 CAGGAGCTCCAGGTCCTTCTTGG - Intergenic
982113062 4:152073603-152073625 CTGCAGTACAAGCTCCTGCCTGG + Intergenic
982597406 4:157404013-157404035 CTGCAGCAGCAGATCCTTCATGG - Intergenic
982817446 4:159904425-159904447 CAGCAGCACCGGCTGCTTGTTGG + Intergenic
984995384 4:185425766-185425788 CGGCAGGACCAGCTCCTTTCAGG + Intronic
985506111 5:281413-281435 TGGCAGCACCAGCTCTTCCCTGG - Intronic
985624799 5:979753-979775 CAGGAGGACCAGCACCATCCAGG - Intronic
985682585 5:1264349-1264371 CAGCAGCACCTGCCCCAGCCGGG + Intronic
986068178 5:4256270-4256292 CATCCACACCAGCACCTTCCAGG + Intergenic
986736585 5:10672935-10672957 CAGCAGCACCAGCTCTTCCTGGG + Intergenic
988065291 5:26224292-26224314 GAACAACATCAGCTCCTTCCCGG + Intergenic
988065315 5:26224496-26224518 TAGCAGCACCAACTCCTTCCAGG + Intergenic
988065646 5:26227017-26227039 GAAAAACACCAGCTCCTTCCAGG + Intergenic
988065739 5:26227753-26227775 GAAAAACACCAGCTCCTTCCGGG + Intergenic
988065786 5:26228061-26228083 CAGCAGCACCAGCTCCTCCATGG + Intergenic
988065803 5:26228172-26228194 CGGTAGCACCAGCTCCTGCCCGG + Intergenic
988739573 5:34056946-34056968 CAGCAGAACCACATCCTTACTGG + Intronic
988801376 5:34699352-34699374 CAGCAGCCTCAGCTCCTTCTGGG + Intronic
990703087 5:58496819-58496841 CAGAAGCACCAGCACCAGCCAGG + Exonic
990900431 5:60743635-60743657 CAGCCGCACCTGCTCCATCAGGG - Intergenic
991427367 5:66505499-66505521 CTGCAACATCAGCTCTTTCCTGG - Intergenic
991906956 5:71524164-71524186 CAGCATCATCATCTTCTTCCTGG - Exonic
992379957 5:76227246-76227268 CAGCTGGGCCAGCTCCTTGCAGG + Intronic
995457494 5:112367567-112367589 CTCCATGACCAGCTCCTTCCAGG + Intronic
996432855 5:123400990-123401012 CAGCCGCACCAGCTACTCCAGGG - Intronic
996597564 5:125222866-125222888 CAGTAGCACCAGCTCAACCCCGG - Intergenic
996605257 5:125313701-125313723 CAGCTGCTCCAGCTCCTGCCTGG - Intergenic
997159594 5:131594168-131594190 CAGCTGCTCCAGCTCCATCTGGG + Intronic
998463653 5:142326308-142326330 CAGCAGGCCCTGCTCCTCCCTGG + Intronic
998687806 5:144549811-144549833 CAGCAGCATCAGTTCATACCCGG - Intergenic
998887129 5:146706275-146706297 CAGCCGCACCAGCTCCACCAGGG - Intronic
999189866 5:149739452-149739474 GAGCAGCTCCCTCTCCTTCCAGG + Intronic
999287433 5:150402495-150402517 CAGCAGGGCCAGCTCCTTTGTGG - Intronic
999399060 5:151250436-151250458 CAGCAGCAGCAGCTCATCCAGGG - Intronic
999419414 5:151427979-151428001 CAGCAGCACCAGCAGATCCCTGG + Intergenic
999904350 5:156123073-156123095 CAGCACCACCAGCTTCCACCTGG - Intronic
999954333 5:156684322-156684344 CAGCAGCATGAGCTCCTCCCAGG + Intronic
1000262697 5:159603150-159603172 CAGGAGCACCTGATCCGTCCTGG - Intergenic
1000885825 5:166746217-166746239 CAGCAGCATCAGCACCTCCTAGG - Intergenic
1001149933 5:169218412-169218434 CAGCAGCATCAGCATCTTCTAGG + Intronic
1001211357 5:169812955-169812977 CAGCAGCATCTGCCGCTTCCCGG - Intronic
1001266257 5:170276594-170276616 CAGCTCCCCCAGCTCCATCCTGG - Intronic
1002098702 5:176846815-176846837 CAGCAGCCCCAGCTCCCTCCGGG - Intronic
1002271930 5:178078232-178078254 CACCAGCAGCAGCATCTTCCAGG + Intergenic
1002441896 5:179268729-179268751 CAGCAGGACCAGGGCCTGCCTGG + Intronic
1002579149 5:180197127-180197149 CTGCAGCACGATCCCCTTCCTGG + Intronic
1002640805 5:180629783-180629805 CAGCAGCTCCAGCGACTTCCTGG + Exonic
1003064513 6:2891869-2891891 CAGCAGGCTCAGCTCCTTCCTGG + Exonic
1003146113 6:3511919-3511941 AAGAAGCACCAGCACCTTCTGGG - Intergenic
1003249459 6:4413224-4413246 CAGCAGCAGCAGCATCTCCCGGG + Intergenic
1003448032 6:6202900-6202922 CAGCAGCACCATCCCCTGCTGGG + Intronic
1003453711 6:6261477-6261499 CAGCAGCAACAGCATCTCCCAGG + Intronic
1003551478 6:7106128-7106150 CAGCTGAATCAGCTCCTTCTTGG + Intergenic
1003624158 6:7727298-7727320 CAGCAGCAGCAGCTGCCTCGCGG + Exonic
1004043420 6:12005094-12005116 CAGCATAACCAGCTGGTTCCTGG - Intergenic
1005315559 6:24599693-24599715 CAGCAGCACCAACTCCTTCAGGG + Intronic
1005595185 6:27372417-27372439 CAGCAGCACCAGCATCACCCGGG + Intergenic
1006098281 6:31669787-31669809 CAGCAGCATGAGCCCCATCCAGG - Intronic
1007164274 6:39817698-39817720 CTGCAACATCAGCTCTTTCCTGG - Intronic
1007229198 6:40336680-40336702 GAGCAGCACGGGGTCCTTCCAGG + Intergenic
1007341215 6:41192570-41192592 CACCAGCCCCAGCCCCTTTCTGG + Intronic
1007399372 6:41595077-41595099 CATGTGCACCAGATCCTTCCTGG + Intronic
1007642801 6:43356109-43356131 CAGCAGTACCAGCTCCAGCCAGG - Exonic
1007747625 6:44052722-44052744 CTGCAGCGCCAGCTGCTTTCTGG + Intergenic
1007985708 6:46205265-46205287 CAGCACCACCTGCTCCTCCAGGG - Intergenic
1008044656 6:46839163-46839185 CAGCAGCACCTCCTCCATGCAGG + Exonic
1010652232 6:78468489-78468511 CAGCTGCATCAGCTCCTTTAAGG - Intergenic
1010995905 6:82532116-82532138 CTGCAACATCAGCTCTTTCCTGG + Intergenic
1013093216 6:106920276-106920298 CTGCAACATGAGCTCCTTCCTGG - Intergenic
1014446664 6:121535842-121535864 CAGCATCTCCAGCTCCTGCTGGG - Intergenic
1014871215 6:126598664-126598686 CAGCTGCATCAGCTCCTTTAAGG + Intergenic
1015168776 6:130228274-130228296 CTGCAGCTAGAGCTCCTTCCAGG + Intronic
1015226675 6:130865016-130865038 CAGCAGCATCAGCTTCACCCGGG - Intronic
1015919803 6:138255511-138255533 CAGCAGCACCAGTACCAGCCTGG + Exonic
1017009258 6:150052311-150052333 CTGCGGAACCAGCTCCTCCCCGG + Intergenic
1017009281 6:150052462-150052484 CAGCAGCACCAGCTACTCCCTGG + Intergenic
1017009321 6:150052684-150052706 CAGCAGCACCGGCTCCTCCCTGG + Intergenic
1017009340 6:150052797-150052819 CGGTAGCACCAGCTCCTGTCCGG + Intergenic
1017009347 6:150052850-150052872 CAGCAGCATCGCCTCCTCCCTGG + Intergenic
1017009372 6:150052956-150052978 CGGCAGCAACAGCTCTTCCCCGG + Intergenic
1017009380 6:150053009-150053031 CAGCAGCACGAGCCTCTCCCCGG + Intergenic
1017009439 6:150053394-150053416 CAGCAGCACTGGCTCCTCCCTGG - Intergenic
1017009468 6:150053548-150053570 CAGCAGCAGCAGTTCCTCCCCGG - Intergenic
1017009495 6:150053733-150053755 CAGCAGCACCGGCTCCTACCCGG + Intergenic
1017009517 6:150053837-150053859 GAACAGCATCGGCTCCTTCCTGG + Intergenic
1017009548 6:150054029-150054051 CAGCAGCACTGGCTCCTGCCTGG + Intergenic
1017009578 6:150054189-150054211 CAGCAGCACCAGCTCCTCCTGGG + Intergenic
1017009622 6:150054449-150054471 CAGCAGCACCAACTCGTCCCCGG + Intergenic
1017009629 6:150054502-150054524 CAGCAACACCAGCTCCTCCTTGG + Intergenic
1017009734 6:150055199-150055221 CAACAGTACCAGCTCCTCCCCGG + Intergenic
1017009784 6:150055458-150055480 CAGCATCACCAGCTCCTCCCTGG + Intergenic
1017009795 6:150055511-150055533 CGGGAGCACAAGCTCCTCCCTGG + Intergenic
1017009812 6:150055619-150055641 CAGTAGCATCAGCTCCTCCCTGG + Intergenic
1017403460 6:154091150-154091172 CACCACCACCAGCACCATCCTGG - Exonic
1017609793 6:156173403-156173425 CAGCAGCATCAGCACCATCTGGG + Intergenic
1017775184 6:157675120-157675142 CATCAGGGCCAACTCCTTCCTGG - Exonic
1017878945 6:158546484-158546506 TTTCAGCTCCAGCTCCTTCCTGG - Intronic
1018317316 6:162569632-162569654 CAGCTGCACCAGCTCCACCAGGG + Intronic
1018430133 6:163715696-163715718 CAGCAGCTCCAGTGGCTTCCAGG + Intergenic
1018614880 6:165677287-165677309 CTGCAACACCAGCTCTTCCCTGG + Intronic
1018694119 6:166377229-166377251 CAGCAGCAGCACCAGCTTCCAGG - Intronic
1018891230 6:167984533-167984555 CAGCAGGTGCAGCTACTTCCAGG - Intergenic
1019767285 7:2861016-2861038 CTGTGGCACCAGCTCCTGCCTGG + Intergenic
1019831624 7:3336370-3336392 GAGCATCACCTGCTCCTACCAGG - Intronic
1020486205 7:8724110-8724132 CAACAACAGCTGCTCCTTCCAGG + Intronic
1021903399 7:25310092-25310114 CAGCAGCATCAGCACCATCTGGG + Intergenic
1021932633 7:25596786-25596808 CAGACGCACCAGCTCCTAGCAGG - Intergenic
1021973595 7:25989269-25989291 GAGCAGCAGCTGCTCCTTGCTGG + Intergenic
1022124076 7:27338966-27338988 CTCCAGCACCAGCTTCTTCTTGG + Intergenic
1022443672 7:30452952-30452974 CAGCAGCAGCTCCTCCTTCTGGG + Exonic
1022528158 7:31051766-31051788 AAGCACCACCATCCCCTTCCTGG + Intergenic
1022649120 7:32258831-32258853 CAAAAGGCCCAGCTCCTTCCAGG + Intronic
1022793597 7:33714308-33714330 CAGCGGCACCAGCCCCCGCCAGG + Intergenic
1023727475 7:43159019-43159041 CAGCAGCTCCAGCACCATCTGGG - Intronic
1023733844 7:43217917-43217939 CACCAGCACCCGATCCTTCTGGG + Intronic
1023879922 7:44312517-44312539 AAACAGCCCCAGGTCCTTCCCGG + Intronic
1024156778 7:46634102-46634124 CAGACGCATCAGCTCCTCCCGGG + Intergenic
1024394303 7:48848219-48848241 CTGCACCACCTCCTCCTTCCGGG - Intergenic
1024951160 7:54861767-54861789 TAGCACCACCAGCTCACTCCTGG + Intergenic
1024986939 7:55202364-55202386 CAGTAGCACCAGCACCCACCAGG + Intronic
1025233145 7:57216365-57216387 CAGCAGCACCATCTTCTCCCTGG - Intergenic
1025233150 7:57216418-57216440 CGACAACACCAGCTCCTTTCTGG - Intergenic
1025233168 7:57216527-57216549 CAGCAGCACCAGCTCCTTCCTGG - Intergenic
1025233347 7:57217606-57217628 CAGCAGCACCGGCTCTTCCTTGG - Intergenic
1025233354 7:57217659-57217681 CAGCAGCACCGCCTCCTCTCTGG - Intergenic
1025233435 7:57218115-57218137 CAGCAGCACTGGCTCCTCCCTGG - Intergenic
1025233465 7:57218274-57218296 CAGCAGCACCACTGCCTCCCTGG - Intergenic
1025233508 7:57218538-57218560 CAGCAGCACCAGCTCCTCCCTGG - Intergenic
1025233642 7:57219284-57219306 CAGCAGCAGCAGATCCTTCCGGG + Intergenic
1025233650 7:57219338-57219360 CAGCAGCACCGGCTCCACCCTGG + Intergenic
1025233660 7:57219391-57219413 CAGCAGCACTGACTCCTCCCTGG + Intergenic
1025233699 7:57219614-57219636 CAGCAACACCGGTTCCTCCCTGG - Intergenic
1025233708 7:57219667-57219689 CAGCAGCATCGGCTCCTCCTTGG - Intergenic
1025233907 7:57220798-57220820 CAGCAGCACCGGCTCCTCTCTGG - Intergenic
1025233938 7:57220956-57220978 CAGCAGCACCGCCGCCTCCCTGG - Intergenic
1025233999 7:57221326-57221348 CAGCAGCACCAGCTACTCCCTGG - Intergenic
1025234018 7:57221432-57221454 CAGCAGCACCAGCTCCCCCGTGG - Intergenic
1025234025 7:57221484-57221506 CTGCAGCACCAGCTCCACCTGGG - Intergenic
1026742695 7:72989084-72989106 CCCCAGCTCCAGCTCCCTCCAGG - Intergenic
1026802544 7:73409484-73409506 CCCCAGCTCCAGCTCCCTCCAGG - Intergenic
1026866970 7:73830033-73830055 CAGCACCACCACCTCCACCCTGG + Exonic
1026905749 7:74061861-74061883 CAGCAGGCCCAGTCCCTTCCTGG - Intronic
1027028808 7:74873789-74873811 CCCCAGCTCCAGCTCCCTCCAGG - Intergenic
1027101040 7:75375993-75376015 CCCCAGCTCCAGCTCCCTCCAGG + Intergenic
1029310728 7:99661218-99661240 CAGCAGCACCAGCCACATCTGGG + Intronic
1029331410 7:99859255-99859277 CAGCAGCACCAGCAGCATCTGGG - Intronic
1029558775 7:101288721-101288743 CCGCAACACCAACTCTTTCCTGG + Intergenic
1032520644 7:132541352-132541374 CAGCAGCACCGGCTCTCTCTGGG - Intronic
1032677131 7:134141382-134141404 CAGCAGCATCAGCCTCATCCAGG - Intronic
1032738132 7:134711519-134711541 CAGCAACACCAGCTCTTCCCTGG + Intergenic
1034331531 7:150287355-150287377 CAGCAGCAGCAGCAGCATCCTGG - Intronic
1034338326 7:150337488-150337510 CAGCCGGAGCAGCTCCATCCTGG + Exonic
1034400114 7:150856619-150856641 CTGCAGCCTCAGCTCCTTCTTGG - Exonic
1034794905 7:154004280-154004302 GAGCAGCACCTGCTACTTCCTGG + Intronic
1035590883 8:812202-812224 CTGCAGTACCAACTCCTCCCTGG - Intergenic
1035691936 8:1565613-1565635 CGGCAGCATCAGCTCCTTTTTGG - Intronic
1035931362 8:3783615-3783637 CAGAAGAACCAGCTGCATCCAGG - Intronic
1035939988 8:3888689-3888711 CAGCAGCACCATCTCTGTCCCGG - Intronic
1036766133 8:11550361-11550383 CAGGAGAACCAGCAGCTTCCGGG + Intronic
1036784704 8:11678358-11678380 CAGCAGCCCCACCGGCTTCCAGG + Intronic
1037518195 8:19654442-19654464 CAGCAGCCCCAACTCCTTAATGG + Intronic
1037801395 8:22037724-22037746 CAGCAGGACCAGCTCCCCACTGG - Intergenic
1038024695 8:23578040-23578062 CACCAGCTTCAGCTCCTTTCCGG + Intergenic
1038263983 8:26022688-26022710 CACCAGCTCCAGCTCCTTGGTGG + Intronic
1038659636 8:29486126-29486148 CTCCATCACCAGCTCCTGCCAGG - Intergenic
1039010194 8:33085460-33085482 CAGCAGCATAACCTCCATCCAGG + Intergenic
1039099052 8:33921243-33921265 CAGCAGCATCAGCAGCTTCTTGG + Intergenic
1039318401 8:36399320-36399342 AAACAGCACCATCTTCTTCCTGG - Intergenic
1039844794 8:41318294-41318316 CAGCAGCACCAGCATCTTCTGGG + Intergenic
1039844859 8:41318796-41318818 CAGCAGCATCAGCATCTTCTAGG + Intergenic
1040829504 8:51661570-51661592 CTGCAACATCAGCTCTTTCCTGG + Intronic
1040967977 8:53102932-53102954 AAGCAGCACAAGCTCTTTGCAGG + Intergenic
1041098696 8:54374735-54374757 CATCAGCAGCATCTCCTGCCTGG - Intergenic
1041304090 8:56441863-56441885 CAGCTGCAGGAGCTCCTTGCAGG + Exonic
1041781202 8:61579575-61579597 CAGCCGCACCAGTTCCTCCAGGG + Intronic
1042482655 8:69321969-69321991 CGGTAGCACCAGCTCCTGTCCGG - Intergenic
1042482725 8:69322477-69322499 GAAAAACACCAGCTCCTTCCAGG - Intergenic
1042482896 8:69323842-69323864 GAGCAGCACCAGCTCCTCCACGG - Intergenic
1042483093 8:69325100-69325122 CAGAAGGATCAGCTCCTCCCTGG - Intergenic
1042483101 8:69325156-69325178 CCGCAGCACCAACTCTTCCCCGG - Intergenic
1042483227 8:69325959-69325981 CAGCAGCACCAGCTCATCCGTGG - Intergenic
1042624759 8:70745598-70745620 CAGCAGCATCAGCAACATCCGGG - Intronic
1042915868 8:73875581-73875603 CAGCAGCAGCAGCAACATCCTGG + Intronic
1042928607 8:73991918-73991940 GAGCAGTCCCAGCTGCTTCCTGG + Intronic
1044147293 8:88732935-88732957 CAGCATCACCAGTTCCTTGTGGG - Intergenic
1044815462 8:96108084-96108106 CTGCAACACCAGCTCTTCCCTGG - Intergenic
1045018371 8:98019339-98019361 CTGCAGCATCAGCTCTTGCCTGG - Intronic
1047343489 8:124005170-124005192 CAGCAACAACACCTCCTACCTGG + Intronic
1047343967 8:124009541-124009563 CAGCAGCACCATCTTCTCCCTGG - Intronic
1047343971 8:124009594-124009616 CAGCAGCACCAGCTCCTGTGTGG - Intronic
1047343992 8:124009703-124009725 CAGCAGCACCAGCTCCTTCCTGG - Intronic
1049206048 8:141364056-141364078 CAGCCCCACCAGCTCCATGCTGG - Intronic
1049302180 8:141877354-141877376 CAGCACCAGCAGGTCCTTCCTGG - Intergenic
1049337945 8:142096521-142096543 CAGCAGCCCCAGCTTCTTGTGGG - Intergenic
1049373447 8:142278406-142278428 AAGCAGGACCAGCTCCTTGAGGG - Intronic
1049560268 8:143306841-143306863 CAGCAGGTCCAGCTCCTCCCGGG - Intronic
1049586672 8:143435622-143435644 CGGGAGCGCCAGCACCTTCCTGG - Intergenic
1049593335 8:143472446-143472468 CAGCAGCACCACAGCCTCCCAGG + Intronic
1049668263 8:143858461-143858483 CAGCAGCACCAGGGCCGTGCCGG + Exonic
1049668679 8:143860060-143860082 CAGCAGCACCAGGGCCGTGCCGG + Exonic
1049669094 8:143861662-143861684 CAGCAGCACCAGGGCCGTGCCGG + Exonic
1049669509 8:143863264-143863286 CAGCAGCACCAGGGCCGTGCCGG + Exonic
1049669919 8:143864857-143864879 CAGCAGCACCAGGGCCGTGCCGG + Exonic
1049670336 8:143866465-143866487 CAGCAGCACCAGGGCCGTGCCGG + Exonic
1049733579 8:144191784-144191806 CAGCTGCCCAAGCTCCTCCCTGG + Exonic
1049812304 8:144580937-144580959 GGGCAGCACCAGCTCCTCCCTGG - Exonic
1050045385 9:1538594-1538616 CAGCAGCTCCAGACCCTACCAGG + Intergenic
1050335432 9:4585380-4585402 CATCTGCTCCAGCTCCTTCTTGG - Exonic
1050633201 9:7582189-7582211 CATCAGTACCTTCTCCTTCCAGG + Intergenic
1052988993 9:34507731-34507753 CAGCAGCAGCCACCCCTTCCTGG - Intronic
1053652937 9:40187743-40187765 CAGCAGCACCTCCTCCATGCAGG - Intergenic
1053903342 9:42817051-42817073 CAGCAGCACCTCCTCCATGCAGG - Intergenic
1054531646 9:66188478-66188500 CAGCAGCACCTCCTCCATGCAGG + Intergenic
1055056022 9:72024996-72025018 CAGCAGCAGCAGCATCTCCCTGG + Intergenic
1055311001 9:74979366-74979388 CAGCAGCAGCAGCTCCTCATTGG - Intergenic
1055768503 9:79691156-79691178 CCACAGCAACAGCTCCTTACTGG + Intronic
1056805098 9:89722215-89722237 CAGCAGAATCAGCACCTTTCTGG - Intergenic
1057276964 9:93681118-93681140 CAGCCGCAGAAGCCCCTTCCAGG - Intergenic
1057305970 9:93912219-93912241 CAACAGCCCCAGCCCCATCCTGG - Intergenic
1057565742 9:96164495-96164517 AAGCAGCACCAGAGCCTTCGGGG - Intergenic
1057943716 9:99306515-99306537 CAGCCGCACCAGCTCCACCAGGG + Intergenic
1058070751 9:100598687-100598709 CAGCCCCACCAGCTCCGGCCAGG - Intergenic
1058910011 9:109512301-109512323 CAGCTGCACCAGCTGCACCCAGG - Intergenic
1059445765 9:114336975-114336997 CAGCAGCTCCAGCCCACTCCTGG + Exonic
1060223434 9:121776190-121776212 CAGCACCGCCAGGTCCTACCAGG - Exonic
1060817535 9:126643027-126643049 CTGCAGCCTCAGCTCCTCCCAGG - Intronic
1061152507 9:128836893-128836915 CACCAGCTCCAGCTCTTCCCTGG + Exonic
1061205659 9:129161704-129161726 CAGCCACACCACCTCCCTCCTGG - Intergenic
1061478343 9:130884135-130884157 CAAACGCAGCAGCTCCTTCCGGG + Exonic
1061501062 9:131002257-131002279 CAGGAGCTTCAGCTCTTTCCCGG + Intergenic
1061506974 9:131036948-131036970 CAGCAGCACCAGCACCAGCTGGG - Intronic
1061572717 9:131487672-131487694 CAGCAGCATCAGCGCCATCTAGG + Intronic
1061713875 9:132506472-132506494 CAGGAGCGCCAGCTGCTGCCGGG - Intronic
1061952091 9:133942340-133942362 TGGCAGCAACAGCTCCTTCGTGG - Intronic
1062034814 9:134378295-134378317 CAGCAACACCAGCACCGGCCTGG - Intronic
1062326759 9:136016269-136016291 CACCAGCTCCAGCTTCTCCCCGG + Exonic
1062486193 9:136777485-136777507 CAGCAGCACTGACTCCTCCCCGG - Intergenic
1062486204 9:136777538-136777560 CAGCAGCACCAGCTCCACCCTGG - Intergenic
1062486215 9:136777611-136777633 GAGCAGCACCGGCTCCTCCCTGG + Intergenic
1062486256 9:136777827-136777849 CAACACCACCAGCTTCTCCCTGG + Intergenic
1062486356 9:136778432-136778454 CAACACCACCAGCTCCTCCCAGG + Intergenic
1062633786 9:137479182-137479204 CAGCAGGATCAGCTGCTTCTGGG + Exonic
1185840253 X:3382948-3382970 CTGCAGCATCAGCTCTTCCCTGG - Intergenic
1186471860 X:9827919-9827941 CAGCAGCATCAGCTTCCTCTGGG + Intronic
1187246288 X:17555499-17555521 CAGCAGCATCAGCCCCATCTAGG - Intronic
1187560177 X:20395204-20395226 CAGCAGGACAAGCTTCTTCGCGG - Intergenic
1188508743 X:30911300-30911322 CACCAGCACTATCTTCTTCCTGG + Intronic
1188564265 X:31507939-31507961 CCACAGCACCAGCACATTCCTGG + Intronic
1189328078 X:40125201-40125223 CAGCAGCTCCAGCAGCTGCCTGG + Intronic
1190941100 X:55041836-55041858 CAGCTGCACCTGCTCCTCCAGGG - Intergenic
1191840849 X:65512834-65512856 CAGCAGCAGCAGCAACTTCGAGG - Exonic
1193468869 X:81875999-81876021 CAGGAGCTCCAGGTCCTTGCTGG + Intergenic
1194917463 X:99723096-99723118 CAGCAACACCTGTGCCTTCCTGG + Intergenic
1196182087 X:112703637-112703659 CACTAGCACCAGTTTCTTCCAGG + Intergenic
1196745751 X:119070502-119070524 CAGGAGTGCCATCTCCTTCCAGG - Intergenic
1197008801 X:121536048-121536070 CAGCTGCATCAGCTCCTTTAAGG + Intergenic
1198987922 X:142477801-142477823 CAGCAGCACCAGCATCATCTGGG + Intergenic
1199849010 X:151711958-151711980 CCTCAGTACCAGCTGCTTCCAGG + Intergenic
1199927327 X:152480928-152480950 CAGCCGCACCAGCTCCACCAGGG + Intergenic
1200049099 X:153419281-153419303 AAGCTGCCCCAGCTCCTCCCGGG - Intronic
1200055472 X:153457717-153457739 CAGGAGCAGCAGCTCCTGCGGGG + Intronic
1200141659 X:153905616-153905638 GAGCAGCGCCAGCTCCGCCCGGG - Exonic
1200141902 X:153906686-153906708 CACCACCGCCAGCTCCTCCCTGG + Exonic
1200903517 Y:8457935-8457957 CAGCTTCACCAGCTCCTTTAAGG - Intergenic