ID: 1047343995

View in Genome Browser
Species Human (GRCh38)
Location 8:124009723-124009745
Sequence CTGTTCTAGGGTGAGAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047343985_1047343995 30 Left 1047343985 8:124009670-124009692 CCTTTGAAGTCTGAGGGTCATTG 0: 1
1: 2
2: 4
3: 25
4: 164
Right 1047343995 8:124009723-124009745 CTGTTCTAGGGTGAGAGTTGAGG No data
1047343992_1047343995 -3 Left 1047343992 8:124009703-124009725 CCAGGAAGGAGCTGGTGCTGCTG 0: 3
1: 6
2: 40
3: 137
4: 701
Right 1047343995 8:124009723-124009745 CTGTTCTAGGGTGAGAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047343995 Original CRISPR CTGTTCTAGGGTGAGAGTTG AGG Intronic
No off target data available for this crispr