ID: 1047344751

View in Genome Browser
Species Human (GRCh38)
Location 8:124016203-124016225
Sequence CCCATTCCTGCCTTTTCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 521}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047344751 Original CRISPR CCCATTCCTGCCTTTTCTTG TGG (reversed) Intronic
901407598 1:9059890-9059912 ATCATTCCTGCCTTGTCATGGGG + Intronic
901450926 1:9336760-9336782 CCCTTTGCTGCCTTTTCATTCGG + Intronic
902001227 1:13195751-13195773 CCCATTCCTGTCTTCTCCTTGGG + Intergenic
902374638 1:16024605-16024627 CGTACTCCTGCCTTTTCTTGGGG + Intronic
902379582 1:16046377-16046399 CGTACTCCTGCCTCTTCTTGGGG + Intronic
902627769 1:17686691-17686713 CCCACTCCTGCCCTTCCTTGTGG - Intronic
903392723 1:22976130-22976152 CCCAGTTCTGCCATTTCTTGGGG - Intergenic
903830308 1:26170469-26170491 CTCCTTCATACCTTTTCTTGTGG - Exonic
904829601 1:33298341-33298363 TCCTTTCCTTCCTTTTCTTAAGG - Intronic
904904590 1:33885567-33885589 CCCATTCCTGCTTCCTCATGTGG - Intronic
905231377 1:36516657-36516679 CCCCTTCCTGCCTCTGCTGGTGG + Intergenic
905656141 1:39687177-39687199 CCCCTCCCTGGCTTTTCCTGAGG - Intronic
905815725 1:40949327-40949349 GCCATTCTTTCCATTTCTTGTGG - Intergenic
905843781 1:41208761-41208783 ATCATTCCTGCTTTCTCTTGTGG - Intronic
907435794 1:54446374-54446396 ATCATTCCTGCTTTCTCTTGTGG + Intergenic
907598226 1:55740145-55740167 CCCTTGCCTGCCTTTTTATGGGG + Intergenic
907994298 1:59613530-59613552 ACCTTTCCTGCTTTCTCTTGTGG - Intronic
908261076 1:62339563-62339585 CCCATCTCTGCCTGGTCTTGGGG + Intergenic
910074994 1:83266498-83266520 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
910816848 1:91299817-91299839 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
911106562 1:94137134-94137156 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
911670398 1:100601347-100601369 CTCTTTCCTGCTTTTTCTTGTGG + Intergenic
912058216 1:105631920-105631942 TCCATTCCTTTCTTTTCTTCTGG - Intergenic
912183061 1:107241678-107241700 CCAATGACTGCATTTTCTTGAGG - Intronic
912303876 1:108544891-108544913 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
912896666 1:113599102-113599124 CTCTTTCCTGCTTTCTCTTGTGG - Intronic
912940214 1:114038186-114038208 CCCATGCCTGCCTGTCCTGGGGG - Intergenic
913090564 1:115473970-115473992 CACATTCCTTCCTTTTCCTTGGG - Intergenic
915072466 1:153282075-153282097 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
916543581 1:165781149-165781171 CTCTTTCCTGCTTTCTCTTGTGG + Intronic
916948442 1:169755085-169755107 CCCTTTCCTCCCTTCTCTTTGGG - Intronic
917313225 1:173698702-173698724 ATCATTCCTGCTTTCTCTTGTGG - Intergenic
917881778 1:179344186-179344208 CCCCTTCCTTCCTGTTTTTGGGG + Intronic
917919137 1:179735327-179735349 CTGATTTCTGCCTTTTCTTGGGG - Intergenic
918700439 1:187600565-187600587 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
918836373 1:189471845-189471867 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
919060337 1:192623948-192623970 ATCATTCCTGCTTTCTCTTGTGG + Intergenic
921087670 1:211811284-211811306 CCCAAGCCTGCCTTATCTTTTGG - Intronic
921848390 1:219907861-219907883 TCCATTCCTGCCTGTTCCTCAGG - Intronic
922098785 1:222465257-222465279 CCCTTGCCTGCTTTTTGTTGGGG - Intergenic
922806453 1:228392596-228392618 CCCATTCTTGTCTTTTTTTTTGG + Intergenic
924525502 1:244844250-244844272 CCCATGCCCACCTTTTCTTGTGG + Exonic
924561951 1:245164542-245164564 CCTATGCCTGCCGTTTCCTGTGG - Intronic
1062810712 10:462062-462084 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
1064140390 10:12785292-12785314 CCCTTTCCTGCTTTGTCTGGAGG + Intronic
1064813405 10:19228948-19228970 CCCATACAGGCCTTTTTTTGGGG - Intronic
1064919270 10:20498735-20498757 GTCTTTCCTGCTTTTTCTTGTGG + Intergenic
1065595053 10:27302262-27302284 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1067181521 10:43990142-43990164 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1067191895 10:44077867-44077889 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
1067555406 10:47266269-47266291 TCCATTCTTGACTTTTCCTGTGG - Intergenic
1068461968 10:57341005-57341027 TGCATTCCTGCTATTTCTTGTGG + Intergenic
1070343373 10:75518810-75518832 ATCTTTCCTGCCTTCTCTTGTGG + Intronic
1070455587 10:76611556-76611578 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1070625383 10:78047402-78047424 CCCATCCCTGCCTTTTCACTTGG + Intronic
1071190365 10:83092222-83092244 CTCTTTCCTGCTTTCTCTTGCGG - Intergenic
1071946258 10:90648519-90648541 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
1072287559 10:93930677-93930699 ATCTTTCCTGCCTTCTCTTGTGG - Intronic
1072376988 10:94827772-94827794 ATCTTTCCTGCCTTCTCTTGTGG + Intronic
1072549331 10:96465523-96465545 CTCTTTTCTTCCTTTTCTTGAGG - Intronic
1073255486 10:102148280-102148302 CCCAGTCCTGCCTTTCTTTTAGG - Intronic
1073284577 10:102379987-102380009 CCCATACCTGCCTTTTCCCGAGG + Intronic
1073451480 10:103612181-103612203 CCCAATAATGCCTTTTGTTGAGG - Intronic
1073514376 10:104063897-104063919 CCCAATCCTGGCATTTCTTCTGG - Intronic
1074000776 10:109370265-109370287 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
1074084165 10:110194954-110194976 CGGTTTCCTGCCTTTTCTTCAGG - Intergenic
1074598485 10:114889416-114889438 TTCATTCTTGCCTTTTTTTGTGG + Intronic
1074631197 10:115256745-115256767 ATCTTTCCTGCCTTCTCTTGTGG + Intronic
1076069401 10:127474744-127474766 CCCATTCCTGCCTTGGCTCTTGG - Intergenic
1076119550 10:127924547-127924569 CCCATGTCTGCCTGATCTTGTGG - Intronic
1076319525 10:129567482-129567504 CCCATTCCTGAATCTTCTTAGGG - Intronic
1076434856 10:130433342-130433364 CTCATTCATGCCTTTTCTGAAGG + Intergenic
1076665784 10:132090813-132090835 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1076665791 10:132090887-132090909 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1078017016 11:7623743-7623765 CCCATTTCTCCCTTTCTTTGTGG - Intronic
1078051347 11:7967458-7967480 CCCATTCCTGCCTGTTCCCCTGG - Intergenic
1078255128 11:9652300-9652322 TTCATTACTGCCATTTCTTGAGG - Intergenic
1078321877 11:10342673-10342695 ATCTTTCCTGCCTTCTCTTGTGG - Intronic
1078698036 11:13654285-13654307 ACCACTCCTGCTTTCTCTTGTGG - Intergenic
1078742639 11:14081541-14081563 CCTATGCCTGCCTTTTGTTTGGG + Intronic
1079060478 11:17244436-17244458 TCCATACCTGCCTTGTCTTCCGG - Intronic
1079977451 11:27109571-27109593 CACTTTCCTGCCTTTTTTTCTGG - Intronic
1080004144 11:27387464-27387486 CTCATTCTTGCATTTTCTTTAGG - Intronic
1080078656 11:28184368-28184390 ATCATTCCTGCTTTCTCTTGTGG + Intronic
1080118220 11:28644304-28644326 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1080253757 11:30266246-30266268 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
1080291560 11:30676816-30676838 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
1080295699 11:30724634-30724656 CACATTACTGTCTTTTCTGGTGG - Intergenic
1080445183 11:32331701-32331723 CCCACCCCTGCCTTTTCTCCTGG - Intergenic
1081226541 11:40530772-40530794 CCTATTTCTTCCTTTTCTTTTGG - Intronic
1081454114 11:43204339-43204361 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
1081667231 11:44923671-44923693 CTCCTCCCTCCCTTTTCTTGTGG + Intronic
1082017260 11:47499664-47499686 CCCAGTCCTGCCTCTTTCTGTGG - Intronic
1083003396 11:59318574-59318596 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1083939425 11:65887754-65887776 CCCTTTCCTGTCTTTTATGGAGG - Intronic
1084359927 11:68662548-68662570 CCCATTCCTGCATTGGCTTGGGG - Intergenic
1085656339 11:78318620-78318642 ACCATTCCTGCCTTTATCTGTGG - Intronic
1085778829 11:79390268-79390290 ACCATCCCTTCCTTGTCTTGGGG + Intronic
1085829388 11:79883648-79883670 CCTCTTCCTGCCTGTTCATGGGG - Intergenic
1087703505 11:101463914-101463936 ATCATTCCTGCCTTCTCTTGTGG + Intronic
1088033231 11:105277734-105277756 CCCTTTCCAGTCCTTTCTTGGGG + Intergenic
1088411686 11:109541198-109541220 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1088533091 11:110831772-110831794 CTCTTTCCTCTCTTTTCTTGAGG + Intergenic
1089193125 11:116669752-116669774 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1089248565 11:117140326-117140348 ATCTTTCCTGCCTTCTCTTGTGG - Intergenic
1090216033 11:124965749-124965771 ATCTTTCCTGCTTTTTCTTGTGG + Intronic
1091329810 11:134723257-134723279 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
1091959052 12:4675199-4675221 ATCATTCCTGCTTTCTCTTGTGG - Intronic
1092337214 12:7643657-7643679 TGCATTCCTGCTATTTCTTGTGG - Intergenic
1092703539 12:11259352-11259374 ATCATTCCTGCTTTCTCTTGTGG - Intergenic
1093802637 12:23392010-23392032 ACCTTTCCTGCCTTCTCTTGTGG - Intergenic
1094357883 12:29597531-29597553 CCCTTTCCTGCCTCACCTTGGGG + Intronic
1094491943 12:30966235-30966257 TCCCCTCCTGCCTTTTCTTATGG - Intronic
1095067000 12:37789919-37789941 ATCATTCCTGCTTTCTCTTGTGG - Intergenic
1095429197 12:42114162-42114184 ACCTTTCCTGCTTTCTCTTGTGG - Intronic
1095798746 12:46249368-46249390 CTCTTTCCTGCTTTCTCTTGTGG - Intronic
1095830697 12:46583408-46583430 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
1097722146 12:63033392-63033414 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
1098015259 12:66097843-66097865 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
1099973017 12:89519132-89519154 CCCATTGCTTCCTTTTATAGTGG + Intronic
1100155626 12:91796818-91796840 CCCTTTTCTACCTTTTCTTCAGG + Intergenic
1100911849 12:99373210-99373232 CCTATTCCTGCCCTTTCCTTGGG - Intronic
1101000631 12:100354001-100354023 TTCATTTCTTCCTTTTCTTGAGG - Intergenic
1102497122 12:113327394-113327416 CCCATTCCTGTCTAGGCTTGTGG - Intronic
1103282476 12:119771472-119771494 GCCATTCCAGGCTTCTCTTGGGG - Intronic
1103733874 12:123046180-123046202 CCCAGTCCTGCCTTTCCTGAAGG + Intronic
1104528472 12:129547106-129547128 CCCATTGCTGCCTCTGCTTCTGG + Intronic
1104736053 12:131136576-131136598 CCCATGCCTGCCCTTCCTTGGGG - Intronic
1105678247 13:22698929-22698951 CCCAAACCTGTCGTTTCTTGGGG + Intergenic
1105938208 13:25121209-25121231 CCCAGTGCTGTCTTTTATTGTGG - Intergenic
1105956955 13:25292539-25292561 GCCCCTCCTGCCTTTTCTTGTGG - Intergenic
1106608380 13:31253245-31253267 ATCTTTCCTGCCTTCTCTTGTGG - Intronic
1106719303 13:32422320-32422342 CCCTTTCCGGCCTCTTCTTTTGG + Intronic
1106784335 13:33092108-33092130 CCAAATCCCACCTTTTCTTGTGG - Intergenic
1106914307 13:34495982-34496004 ATCTTTCCTGCTTTTTCTTGGGG - Intergenic
1107448023 13:40485337-40485359 CCCATGCCTGCCACTTCCTGCGG - Intergenic
1107650680 13:42541700-42541722 CCCATTACTCCCTTGTCTTTTGG + Intergenic
1109335644 13:60990597-60990619 CCCTTTCCTGCCCTTTCTCTTGG - Intergenic
1112233298 13:97610665-97610687 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1113323862 13:109264959-109264981 CCCATCCCAGCCTTTTATTATGG - Intergenic
1113872579 13:113569212-113569234 CCCATTACTGCCTGTAGTTGTGG + Intergenic
1114245929 14:20913611-20913633 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1115314640 14:32013201-32013223 CCCATTCCTGGCGGTTCCTGAGG + Intronic
1116777072 14:49193497-49193519 CCATTTCCTGCCCTTTCCTGAGG + Intergenic
1116780157 14:49228097-49228119 CCCATTCCTGCAGTTTGATGAGG - Intergenic
1117045837 14:51812447-51812469 AGCATTCCTGCATTTTCTTCTGG - Intergenic
1117377170 14:55127562-55127584 CACACTCTTGCCTTTTCTTCTGG - Intronic
1117399663 14:55347236-55347258 CCCATGCCTGCCTTTGTGTGTGG + Intronic
1117822625 14:59666473-59666495 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
1118569337 14:67177186-67177208 ATCTTTCCTGCTTTTTCTTGTGG + Intronic
1118958394 14:70504325-70504347 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
1119846815 14:77836670-77836692 CCCTTCCTTGCCTTTTCTGGTGG + Intronic
1120436187 14:84485756-84485778 CCCCTTCCTGCCTGATCTTCCGG - Intergenic
1120757075 14:88254420-88254442 CCCATGGCTGCCATTTCTTCTGG - Intronic
1121305688 14:92905526-92905548 CTCAGTCCTGCCATTTCCTGAGG - Intergenic
1122057815 14:99116802-99116824 CCCATTCTTGCCTCTCCTTCTGG - Intergenic
1125185714 15:36927368-36927390 CCCATTCTTGCCTTTTTTCCAGG - Intronic
1125758587 15:42082363-42082385 CCCATTCCAGCCATTGCTTCTGG + Exonic
1125822895 15:42648805-42648827 CCCATTCTTTCCTCTTCTTTTGG + Intronic
1126502107 15:49357117-49357139 ATCTTTCCTGCCTTCTCTTGTGG - Intronic
1126505420 15:49398881-49398903 ATCTTTCCTGCCTTCTCTTGTGG - Intronic
1126542224 15:49836332-49836354 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
1127317569 15:57812236-57812258 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
1128690768 15:69723282-69723304 CTCATTCCTGCCTGTTCTGCTGG + Intergenic
1129219174 15:74121544-74121566 CTCCTTCCTGCCTCATCTTGGGG - Intronic
1129516614 15:76161218-76161240 CTCGTTCCTGCCTTTCCCTGAGG - Intronic
1129598434 15:76982857-76982879 CCCATTCCTGCCCATTCCTCTGG - Intergenic
1129867806 15:78922599-78922621 CCCATGCCAGCCTTTTCTCCCGG + Intronic
1130163061 15:81421516-81421538 TGCTTTTCTGCCTTTTCTTGAGG + Intergenic
1130435841 15:83898596-83898618 CCCATTTCTGCTCTTTCATGTGG - Intronic
1132735349 16:1383352-1383374 CCCATCCCTGCATCTGCTTGGGG - Intronic
1132747369 16:1442640-1442662 CCCATTCCTCTGTTTTCTGGTGG - Intronic
1133264366 16:4574642-4574664 CCCACCCCTGCCTTTTCCCGTGG - Intronic
1134886570 16:17798470-17798492 TCCATTCCTGCCATTTTTTATGG + Intergenic
1136387834 16:29941083-29941105 CCCACTCCTGCCTTCTCTGGGGG - Intronic
1136411661 16:30081189-30081211 CCAATTCCTGACCTTTTTTGGGG - Intronic
1137681141 16:50346302-50346324 ATCTTTCCTGCCTTCTCTTGTGG - Intronic
1138722618 16:59099427-59099449 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
1139814193 16:69654151-69654173 CCCATTCCCCCATTTTTTTGAGG - Intronic
1140035383 16:71367765-71367787 CACATTTCTGCCTTTTGTTGAGG + Intronic
1140692979 16:77502218-77502240 CCTACTCCTGCCTTCTCTTCTGG - Intergenic
1142308096 16:89296864-89296886 CCCATTCCTGCCCTCTGGTGGGG - Intronic
1143045917 17:4079389-4079411 CCCATACCTTCCCTTTCTTCTGG - Intronic
1146145227 17:30409965-30409987 CTCTTTCCTGCTTTCTCTTGTGG + Intronic
1146637035 17:34514180-34514202 CCCACTCCTGCCATTGCTTTGGG - Intergenic
1146766473 17:35526741-35526763 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
1146974117 17:37096460-37096482 CCAAATCCAGCCTTTTCTTCTGG + Intronic
1148026665 17:44593542-44593564 CCCATGCCTGCCTCTACCTGGGG + Intergenic
1148446729 17:47742619-47742641 CCCATTCCTGTCATTTACTGTGG + Exonic
1148566352 17:48635219-48635241 CACTTTGGTGCCTTTTCTTGGGG - Intergenic
1148725581 17:49787712-49787734 CACTTTCCAGCCTTTTCTTAAGG + Intronic
1149707334 17:58706649-58706671 ACCATTCTTTCCTTTTCTTGAGG + Intronic
1150282706 17:63938631-63938653 CCCATTCCTGCCTGGTCCAGTGG - Exonic
1151086869 17:71390166-71390188 CTCATTCCTGTGTCTTCTTGGGG + Intergenic
1151110411 17:71669553-71669575 CCCATTTGTGACTTTTATTGAGG - Intergenic
1151805252 17:76400922-76400944 CCCTTTCCTTCCTGCTCTTGAGG - Intronic
1153726121 18:7957189-7957211 CACATTTTTGCCTTTTCTTTTGG + Intronic
1153888738 18:9492668-9492690 TCCATTGCTGCCTTTTTTGGGGG + Intronic
1155404933 18:25477419-25477441 CCCATCCCTCCCTTTTCTCTGGG + Intergenic
1155626654 18:27842971-27842993 GCCATTGTTCCCTTTTCTTGAGG - Intergenic
1156670230 18:39459845-39459867 CCCACTCCTATCTTTTCTTCAGG - Intergenic
1156855137 18:41773081-41773103 CCCATTCCTGATTTTCCTGGTGG - Intergenic
1158843491 18:61414655-61414677 CCCATTCATGCCTTTATTTTAGG - Intronic
1160035513 18:75298033-75298055 CTCATTCCTGGCTTCTCTTCTGG - Intergenic
1160155848 18:76433354-76433376 GCCAGACCTGCTTTTTCTTGAGG - Intronic
1160331485 18:77996090-77996112 GCCATCCCAGCCTTTTCTTAAGG + Intergenic
1161431117 19:4233026-4233048 CCTGTTCCTGCCTCTCCTTGGGG + Intronic
1162287557 19:9750667-9750689 CCCATTAATCCCTTTACTTGTGG + Intergenic
1162530288 19:11232048-11232070 CCCTCTCCTGCCTTTGTTTGGGG - Intronic
1164176598 19:22780873-22780895 CCAATTACCACCTTTTCTTGTGG + Intronic
1164340911 19:24396828-24396850 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1164341785 19:24409027-24409049 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1164416969 19:28054408-28054430 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1164688391 19:30187766-30187788 ATCATTCCTGCTTTCTCTTGTGG + Intergenic
1165418641 19:35711279-35711301 CGCACTCCTTCCTTGTCTTGAGG + Intronic
1165606300 19:37107598-37107620 CCCATTTCCCCCTTTTCTTTTGG + Intronic
1168331796 19:55574576-55574598 CCCTTTCTTGCTGTTTCTTGTGG + Intergenic
1202669244 1_KI270709v1_random:36068-36090 CTTAATCCTGCCTTTTCCTGAGG - Intergenic
926040701 2:9670559-9670581 CCCTTTCCTGGATTTTTTTGGGG + Intergenic
926567438 2:14491470-14491492 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
927049073 2:19308735-19308757 ATCATTCCTGCTTTCTCTTGTGG - Intergenic
928569431 2:32588530-32588552 CCATTTCCTGCATTTTATTGTGG + Intronic
928930922 2:36623273-36623295 CCCTTTTCTGCCTTTTTTTTAGG - Intronic
930216712 2:48704998-48705020 ATCTTTCCTGCCTTTCCTTGTGG + Intronic
930564907 2:53006583-53006605 CAAATTCCTGGTTTTTCTTGTGG - Intergenic
930801273 2:55445123-55445145 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
930905636 2:56563137-56563159 ACCATTCCTGCATTGTCTTTCGG + Intergenic
932209227 2:69914195-69914217 CCGATTCCAGCTCTTTCTTGAGG + Intronic
932999776 2:76907375-76907397 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
933739053 2:85518539-85518561 CCCATTCCTTCATTGTTTTGGGG - Intergenic
933898642 2:86833650-86833672 TTCCTTCCTTCCTTTTCTTGGGG + Intronic
934899029 2:98142329-98142351 CCAGTTCCTGTCTTCTCTTGGGG + Intronic
935540108 2:104338554-104338576 CCCAGTGCTGCCTTCCCTTGAGG - Intergenic
935566359 2:104612206-104612228 CCTCTTCCTGCCTTTTCCCGTGG + Intergenic
936691347 2:114892857-114892879 CCCATCACTGCCATTTTTTGGGG - Intronic
936800957 2:116265129-116265151 CCCAATGGTGCCTTCTCTTGGGG + Intergenic
936902632 2:117500853-117500875 CTCATTCCTGCCATAGCTTGAGG + Intergenic
937367326 2:121273033-121273055 CCCATGCTTGCCTTTGCATGTGG + Intronic
937481815 2:122269310-122269332 CCCATTCGTGCATTTTCATCTGG - Intergenic
938150055 2:128874796-128874818 TCCAATCCTTCCTTCTCTTGCGG + Intergenic
938834449 2:135085658-135085680 GCCATTACTGTCTTTTCTTTAGG + Intronic
938868494 2:135449757-135449779 CCCATTTCTTTCTTTTTTTGAGG + Intronic
939838095 2:147153818-147153840 ATCTTTCCTGCCTTCTCTTGTGG - Intergenic
940006867 2:149016323-149016345 CCCATTCCTACCCCTTCTTCAGG - Intronic
940039016 2:149340034-149340056 ACTATTTCTGCCTTTTCTTTTGG + Intronic
941100451 2:161289210-161289232 ATCTTTCCTGCCTTCTCTTGTGG - Intergenic
941534450 2:166705838-166705860 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
941546413 2:166856723-166856745 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
942036700 2:172016919-172016941 CTAATTCCTGCTTGTTCTTGAGG + Intronic
942196916 2:173530402-173530424 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
942780184 2:179632584-179632606 ATCTTTCCTGCCTTCTCTTGTGG - Intronic
942955644 2:181769726-181769748 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
943583795 2:189714644-189714666 CCAATTCCTGCTTTGTCTTGTGG - Intronic
944033614 2:195266822-195266844 ATCATTCCTGCTTTCTCTTGTGG + Intergenic
944254524 2:197611720-197611742 ATCATTCCTGCTTTCTCTTGTGG + Intronic
944412547 2:199458179-199458201 CCCACTCCCCTCTTTTCTTGCGG - Intronic
945635635 2:212346313-212346335 CCAATTTGTGGCTTTTCTTGGGG - Intronic
945652614 2:212583506-212583528 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
947056530 2:226110282-226110304 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
947415744 2:229893857-229893879 GCCATGCCTGGCTTTCCTTGTGG + Intronic
947514143 2:230786337-230786359 CTCTTTCCTTCCTTTTTTTGGGG + Intronic
947781776 2:232772789-232772811 CCACTTCCTGCCTTTTAATGGGG + Intronic
947802957 2:232943156-232943178 CTCCTTCCTTCCTTTTTTTGTGG + Intronic
948498812 2:238375238-238375260 ATCTTTCCTGCTTTTTCTTGTGG + Intronic
1168768029 20:395555-395577 ACAATTCCTGGCTTCTCTTGGGG + Intronic
1168801361 20:645465-645487 CCCATTCCTGTCTATACTGGGGG - Intergenic
1170149421 20:13213946-13213968 CCCAGTCCTCCTTTTTCTTTTGG - Intergenic
1170336671 20:15277772-15277794 CCAATTCCTTCCTTTTTCTGAGG - Intronic
1170663531 20:18365112-18365134 CCCATTCCTTCTTTTCCATGAGG - Intergenic
1172168351 20:32912931-32912953 TCCATTCCTGGCTTTCCTGGTGG + Intronic
1173043379 20:39486703-39486725 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1174407535 20:50311900-50311922 CACATTCCTGCGCTTTCGTGAGG - Intergenic
1174726997 20:52873042-52873064 CTTTTTCCTGCCTTTTCTAGTGG - Intergenic
1175972077 20:62691806-62691828 CCATTTCCTGCCTTCACTTGCGG + Intergenic
1176212521 20:63931954-63931976 CCCTTTCCTACCTGTGCTTGAGG + Exonic
1176369879 21:6056241-6056263 CCCATTCTTGCCTTTTGTGAGGG + Intergenic
1176693975 21:9950830-9950852 CTCATTTCTGCCTTTCTTTGAGG - Intergenic
1177116582 21:17093399-17093421 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1177562627 21:22776170-22776192 GCCATCCCTTCCTTTTATTGAGG + Intergenic
1179753640 21:43482300-43482322 CCCATTCTTGCCTTTTGTGAGGG - Intergenic
1179786857 21:43735126-43735148 CCCTTTCCTGCCTTTGCTTGCGG + Intronic
1180020354 21:45120671-45120693 CACATTCCTGCCCTTGCTGGAGG - Intronic
1180956522 22:19743737-19743759 CCCTCGCCTGCCTTTGCTTGTGG - Intergenic
1181271508 22:21661362-21661384 CCCACTCCTGCCTCTCCCTGTGG + Intronic
1181506165 22:23359375-23359397 TCCATTCCTGCCTGCTCTTCAGG - Intergenic
1181795250 22:25303632-25303654 TCCCATCCCGCCTTTTCTTGTGG + Intergenic
1182366925 22:29785375-29785397 CCCAGTCCTGACTATTCATGAGG - Intergenic
1182370334 22:29806048-29806070 CCCAGCCTTGCCTTTTCTAGAGG - Intronic
1182433590 22:30315739-30315761 GCTACTCCTGCCTTGTCTTGGGG + Intronic
1183226296 22:36552284-36552306 CCCTTTCCTGCCTTTTCTCAAGG + Intergenic
1183365310 22:37403656-37403678 GCCTTTTCTGCCTTTTCCTGTGG - Intronic
1183585437 22:38750618-38750640 CCCATTCCAGCACTTTCCTGTGG - Intronic
1183588251 22:38765692-38765714 CCCTTTCCTACCTTTTCTCCAGG - Intronic
1183601969 22:38844870-38844892 CCCATTCCTGCTGTTCCTTCTGG - Intergenic
1183723609 22:39576454-39576476 CCCAGTCCTGGCTTTTATTCAGG + Intronic
1184171928 22:42765050-42765072 CCTCTTCCTGCCCTTTCCTGTGG - Intergenic
1184265806 22:43345199-43345221 TCCATTCCTGCCTTGATTTGTGG - Intergenic
1184886503 22:47348890-47348912 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
949205522 3:1433884-1433906 AACTTTCTTGCCTTTTCTTGGGG + Intergenic
949435497 3:4024854-4024876 AGCATTCTTGCCTTTTCTGGAGG + Intronic
949579591 3:5374425-5374447 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
950187800 3:10956145-10956167 GCCATTCCTGCACTTTGTTGAGG + Intergenic
950302885 3:11897229-11897251 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951361096 3:21725215-21725237 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
951510495 3:23495788-23495810 CCCATTACCTCCTTTTCCTGAGG - Intronic
951575193 3:24106470-24106492 CCCATTCCTGTCTCTTCTATTGG + Intergenic
951759274 3:26127558-26127580 CTTATTCCTGCTTTCTCTTGTGG + Intergenic
952644695 3:35640600-35640622 TCCATTTCTGTCTTTTCTGGGGG - Intronic
953228846 3:41045386-41045408 CACATTTCTGGCTTTTCTTGGGG - Intergenic
953792021 3:45954805-45954827 CCCCTTGCTGCCTCTTCATGTGG - Intronic
954506095 3:51075261-51075283 CCCATACCTGCCACATCTTGTGG - Intronic
955066085 3:55534773-55534795 CAAATTCTTCCCTTTTCTTGGGG + Intronic
955135735 3:56216026-56216048 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
955269223 3:57479953-57479975 ACCTTTCCTGCTTTCTCTTGTGG - Intronic
955282700 3:57609268-57609290 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
955813041 3:62811419-62811441 CCAATGCATGCATTTTCTTGAGG - Intronic
956077242 3:65518497-65518519 CCATCTCCTACCTTTTCTTGTGG - Intronic
956282921 3:67577691-67577713 GCCATTCCTGCCCTTATTTGAGG - Intronic
956772268 3:72536704-72536726 CCCATTCCTGCCTTGCCTGGAGG - Intergenic
958197839 3:90265458-90265480 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
958201340 3:90320345-90320367 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
959764614 3:110010695-110010717 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
960278475 3:115753924-115753946 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
961717654 3:128869742-128869764 CCCATTTCTGCCCCTTCTGGAGG - Intergenic
962233191 3:133684235-133684257 AGCTTTCCTGCCTTCTCTTGTGG - Intergenic
962341206 3:134585296-134585318 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
962632765 3:137296404-137296426 AATATTCCTGCCTTTTCTTGTGG - Intergenic
964582624 3:158257181-158257203 ACCTTTCCTGCTTTCTCTTGTGG + Intronic
964942626 3:162177871-162177893 CACATTCCAACCTTTTCTTCAGG - Intergenic
966406879 3:179607097-179607119 CACATTATTGCCCTTTCTTGGGG + Intronic
967006873 3:185392425-185392447 CCAATTCTTGCCTGTTCTTTAGG - Intronic
967071329 3:185964949-185964971 CCAATTCTTGCCTGTTCTTTAGG + Intergenic
969217421 4:5733451-5733473 CGCATTCCCTCCTTTTCATGGGG + Intronic
970917745 4:21355184-21355206 ACCTTTCCTGCTTTCTCTTGTGG - Intronic
971671607 4:29564765-29564787 ATCTTTCCTGCCTTCTCTTGTGG - Intergenic
971946788 4:33288722-33288744 ATCATTCCTGCTTTCTCTTGTGG + Intergenic
972178505 4:36437188-36437210 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
972327605 4:38032319-38032341 CCCATTTCTTTCTTTTTTTGGGG - Intronic
973542713 4:51950603-51950625 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
973619252 4:52711374-52711396 CCCTTTCCTGTTTTATCTTGGGG + Intergenic
973883824 4:55300167-55300189 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
973930654 4:55790348-55790370 AGCATTCCTGCCTTTCCCTGAGG + Intergenic
974132214 4:57770653-57770675 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
974265862 4:59584910-59584932 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
974845210 4:67343479-67343501 TCATTTCCTGCCTTTTTTTGTGG - Intergenic
976047292 4:80965748-80965770 CCCATCCCTGCTTTTTTTGGTGG - Intergenic
978660960 4:111125800-111125822 CCCATTACTACCTTATCCTGTGG + Intergenic
979085843 4:116408602-116408624 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
979153761 4:117355789-117355811 TTCACTCCTTCCTTTTCTTGAGG + Intergenic
979202376 4:117993858-117993880 CCCATTTCTGTCTTTTCCTGGGG + Intergenic
980662045 4:135873535-135873557 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
982405699 4:155017633-155017655 CACATTCCTTCCTCTTCTTAGGG - Intergenic
982434253 4:155364931-155364953 TCCTTTCTTGCCTTTTTTTGAGG - Intronic
982883582 4:160749794-160749816 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
983364380 4:166767297-166767319 CTCTTTCCTGCTTTCTCTTGTGG + Intronic
984430261 4:179639552-179639574 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
984605645 4:181782729-181782751 ATCTTTCCTGCTTTTTCTTGCGG + Intergenic
984956923 4:185053983-185054005 CCCTTTCCATCCTTTTCTGGGGG + Intergenic
985191579 4:187380399-187380421 CCCAGCCCAGCCTATTCTTGCGG + Intergenic
985203464 4:187507027-187507049 CCCTTTCCAGCCTTTTCACGTGG + Intergenic
985433604 4:189905599-189905621 CCAATCACTGCCTTCTCTTGTGG + Intergenic
986031742 5:3901141-3901163 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
986159254 5:5210144-5210166 CTCAATACTGCCTTTTCTTATGG + Intronic
986775469 5:11009850-11009872 CCCATTTGTGCCTTTGCTTTTGG + Intronic
987873021 5:23644987-23645009 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
988134698 5:27155955-27155977 TCTATTCTTGACTTTTCTTGAGG + Intergenic
989098315 5:37801294-37801316 GGCATTCCTGACTTTTCTAGTGG + Intergenic
989102163 5:37833726-37833748 CTCATTCCTGCTTTATTTTGGGG + Intronic
989357802 5:40564491-40564513 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
989950672 5:50293547-50293569 ATCATTCCTGCTTTCTCTTGTGG + Intergenic
989958133 5:50378515-50378537 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
990060407 5:51639775-51639797 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
990216940 5:53544376-53544398 TCCATTCCTGCCTCATCTTGAGG - Intergenic
990224006 5:53628987-53629009 CTCTTTCCTGCTTTCTCTTGTGG + Intronic
990356354 5:54970196-54970218 TCTATTCCTGCCTTTTATTTTGG - Intergenic
990789503 5:59461034-59461056 TTCATTCCTGACTTTGCTTGAGG - Intronic
991304268 5:65160154-65160176 CCAAATCCTGCCCTGTCTTGGGG + Intronic
993471323 5:88311111-88311133 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
993528016 5:88990529-88990551 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
994262507 5:97676822-97676844 GCCATTTCTTGCTTTTCTTGTGG + Intergenic
995327298 5:110905567-110905589 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
995343666 5:111087992-111088014 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
995475319 5:112541994-112542016 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
995905195 5:117114904-117114926 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
995977361 5:118055998-118056020 CCCATGTCTGCCTTTTATTCAGG + Intergenic
996027706 5:118667122-118667144 CCCATTTTTGTCTTTTCTTCTGG + Intergenic
996202003 5:120686575-120686597 CCCATTCCCCCATTTTCTAGTGG - Exonic
997620881 5:135293187-135293209 CCCATTCTTCCCTTTTCTAAGGG + Intronic
997655633 5:135552251-135552273 CCCATTTCTGTCCTTTCTTGTGG + Intergenic
997903044 5:137785972-137785994 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
999375950 5:151086715-151086737 TGCATACCTCCCTTTTCTTGAGG + Intronic
999944344 5:156579020-156579042 ATCTTTCCTGCTTTTTCTTGTGG + Intronic
1000480711 5:161770005-161770027 CCCCTTCCTGCTATTTCCTGTGG - Intergenic
1000598123 5:163239175-163239197 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1001187391 5:169587707-169587729 CCCAGACCTTCCTTTTCTGGTGG + Intronic
1001403846 5:171462135-171462157 TCCATCCCTGCCTTTGCTGGGGG + Intergenic
1002595997 5:180323715-180323737 CCCCTCCCTGCCTTTGCCTGGGG - Intronic
1003129782 6:3386062-3386084 CCCATTCATGCCCATTCCTGTGG + Intronic
1003438466 6:6117319-6117341 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1003445523 6:6180163-6180185 TGCCTTACTGCCTTTTCTTGGGG + Intronic
1003522361 6:6868914-6868936 CCCCTTCCTGCTCTTTCTTTGGG - Intergenic
1003797867 6:9625615-9625637 CTTTTTCCTGCATTTTCTTGTGG + Intronic
1005202408 6:23362082-23362104 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
1005317045 6:24613135-24613157 AACATTCCTGCCTTTACTTTTGG + Intronic
1006728591 6:36218117-36218139 CCCACTCCTGCTATTTCCTGAGG + Intronic
1007322985 6:41040585-41040607 CCCCTTCCTGGCTTGTCTTTAGG - Intronic
1007845364 6:44750458-44750480 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1008566520 6:52774338-52774360 ATCATTCCTGCTTTCTCTTGTGG + Intergenic
1009943887 6:70320588-70320610 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
1010307371 6:74340891-74340913 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
1010620263 6:78064831-78064853 AGCATTCTTGCCTTTTCTGGAGG + Intergenic
1011058962 6:83240892-83240914 CCCATATGTGCCTTTTCTTTAGG + Intronic
1011144986 6:84204611-84204633 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
1011298011 6:85844543-85844565 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
1011358263 6:86495214-86495236 ACCCTTCCTGCTTTCTCTTGTGG + Intergenic
1011854879 6:91677252-91677274 CTATTTCCTGCCTTTTCTTACGG + Intergenic
1011905136 6:92356204-92356226 ATCATTCCTGCTTTCTCTTGTGG - Intergenic
1012285158 6:97379640-97379662 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
1013649275 6:112177636-112177658 CCCGCTCCTTCCTTTTCTTCTGG + Intronic
1014133080 6:117856837-117856859 TGCATTCCTGCTTTCTCTTGCGG - Intergenic
1014409764 6:121100619-121100641 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
1014602951 6:123437813-123437835 AACATTCCTGCGTTTTTTTGGGG + Intronic
1014749038 6:125234511-125234533 CACATTCCTGCTTTTACTTAAGG + Intronic
1015133299 6:129838468-129838490 CTCTTTCCTGCTTTCTCTTGTGG - Intronic
1015515942 6:134082667-134082689 GGCATTCCTGCCTGTTCTGGAGG - Intergenic
1016352752 6:143185323-143185345 CCCATTTATGCCTCTTCTTAAGG + Intronic
1016460970 6:144279870-144279892 CCCATTCCTGTCCTTTCTATTGG + Intergenic
1016832930 6:148451030-148451052 CACATTCATGCCTTTGCCTGTGG + Intronic
1016876141 6:148867252-148867274 CCCATTTCTACCTTTCTTTGAGG + Intronic
1017130275 6:151102671-151102693 CCCATCCCTGCCCTTTATTTGGG + Intergenic
1017382603 6:153847782-153847804 CCTATCCTTGCCTTTGCTTGAGG - Intergenic
1018158401 6:161012302-161012324 CCCTTTCCTCTCTTTTCTTTTGG + Intronic
1018471227 6:164100369-164100391 CCAATTCCTTCCTTCTCCTGTGG + Intergenic
1018924454 6:168196711-168196733 CCTCTTCCTGCCTTTCCTTTGGG - Intergenic
1021202006 7:17737716-17737738 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
1021593276 7:22288115-22288137 CCCATTCCTTCCTTTTCAGAGGG + Intronic
1022347558 7:29531445-29531467 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
1022824111 7:33991725-33991747 ATCTTTCCTGCCTTCTCTTGTGG + Intronic
1022884647 7:34630236-34630258 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
1023754739 7:43406093-43406115 AGCATTCCTGCCTGTTCTGGAGG + Intronic
1024335737 7:48203579-48203601 CTCATTCCTGCCTTTGTTGGGGG + Intronic
1024435352 7:49346796-49346818 CACATTCCTCCCTTTTTTTCAGG - Intergenic
1024753514 7:52499981-52500003 CCTCTACCTCCCTTTTCTTGTGG + Intergenic
1024803118 7:53103863-53103885 ACCATTCCTGCCTTCTTTTGTGG - Intergenic
1025600916 7:62996313-62996335 ATCATTCCTGCTTTCTCTTGTGG + Intergenic
1026934840 7:74248338-74248360 ACCATGCCAGCTTTTTCTTGTGG - Intronic
1027737021 7:81945379-81945401 CCCACTCCTGCCTCTTCTCTTGG - Intergenic
1027871565 7:83714508-83714530 ATCATTCCTGCTTTCTCTTGTGG + Intergenic
1027918635 7:84360247-84360269 ATCATTCCTGCTTTCTCTTGTGG + Intronic
1028139450 7:87257222-87257244 ATCATTCCTGCTTTCTCTTGTGG - Intergenic
1028144595 7:87307428-87307450 ATCTTTCCTGCCTTCTCTTGTGG - Intergenic
1028159335 7:87467928-87467950 ACCTTTCCTGCTTTCTCTTGTGG - Intronic
1028211564 7:88080379-88080401 ACCTTTCCTGCTTTCTCTTGTGG - Intronic
1028252558 7:88554147-88554169 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1028885719 7:95930487-95930509 CTTTTTCCTCCCTTTTCTTGAGG + Intronic
1029057681 7:97763426-97763448 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
1029347810 7:99991485-99991507 CCAATTCCTGCCTTTTATTATGG + Intergenic
1030989904 7:116287642-116287664 CTCATTCCTCCATTTTCTTCAGG - Intronic
1031803754 7:126280927-126280949 ATCATTCCTGCTTTCTCTTGTGG + Intergenic
1034301195 7:150016793-150016815 ACCATTCCTGCCTGTGCTAGAGG - Intergenic
1034804857 7:154080514-154080536 ACCATTCCTGCCTGTGCTAGAGG + Intronic
1037935868 8:22914698-22914720 CCCAGCCCTGCCTTCTCTTCTGG + Intronic
1038140776 8:24842591-24842613 ATCTTTCCTGCCTTCTCTTGTGG - Intergenic
1038221467 8:25612458-25612480 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
1039154836 8:34543252-34543274 ATCTTTCCTGCCTTCTCTTGTGG - Intergenic
1039170650 8:34741068-34741090 ATCTTTCCTGCCTTCTCTTGTGG - Intergenic
1039849847 8:41355052-41355074 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
1040013885 8:42684792-42684814 ATCCTTCCTGCTTTTTCTTGTGG - Intergenic
1040766724 8:50920004-50920026 ATCTTTCCTGCCTTCTCTTGTGG - Intergenic
1040772048 8:50989589-50989611 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
1042168550 8:65970762-65970784 CCCAATTCTAACTTTTCTTGGGG - Intergenic
1042515520 8:69654830-69654852 CCCATTCCTTCCTGTTCTTATGG + Intronic
1042867822 8:73370932-73370954 TCCATTCCTGGCCCTTCTTGGGG + Intergenic
1043067647 8:75595386-75595408 CCAATTCCTAGCTTTTCCTGAGG - Intergenic
1044458920 8:92421869-92421891 TCTATTCTTGCCTTTTCCTGGGG + Intergenic
1044462769 8:92465323-92465345 CAAATTCTTGCCTTTTCTTTAGG - Intergenic
1044799799 8:95942409-95942431 CTGACTCCTGCCTTGTCTTGGGG + Intergenic
1045134498 8:99199779-99199801 CACATTCCTACCTTTTTTTCAGG + Intronic
1045177555 8:99741857-99741879 ATCTTTCCTGCCTTCTCTTGTGG - Intronic
1045616963 8:103926694-103926716 CCCATTCCTCACATTTCTTATGG - Intronic
1045647292 8:104311596-104311618 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1046896270 8:119476977-119476999 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
1047344751 8:124016203-124016225 CCCATTCCTGCCTTTTCTTGTGG - Intronic
1048117879 8:131545560-131545582 GGCTTTCCTCCCTTTTCTTGTGG + Intergenic
1048273505 8:133047977-133047999 CGCATTCCTGCCTTTCCTGGGGG - Intronic
1050337272 9:4601719-4601741 CCCAGTCCCGGCTTTTCTTGAGG - Intronic
1050387277 9:5103950-5103972 CTCTTTCCTGCTTTCTCTTGTGG - Intronic
1050390280 9:5135655-5135677 CTCTTTCCTGCTTTCTCTTGTGG - Intronic
1051125189 9:13795553-13795575 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1051938048 9:22468416-22468438 CCATTTCCTTCCTTTTCTAGAGG - Intergenic
1052290938 9:26839948-26839970 CCGATTCCTTCCTTTTGTTAAGG - Intergenic
1052451673 9:28638928-28638950 CTCTTTCCTGCTTTCTCTTGTGG + Intronic
1053159881 9:35806552-35806574 CCCCTTCCTGTATTTTCTTTTGG + Intronic
1053630947 9:39936929-39936951 CTCATTTCTGCCTTTCTTTGAGG - Intergenic
1053774821 9:41526576-41526598 CTCATTTCTGCCTTTCTTTGAGG + Intergenic
1054212940 9:62313769-62313791 CTCATTTCTGCCTTTCTTTGAGG + Intergenic
1055178738 9:73355530-73355552 TTCATTCCTACCTTTTCTGGGGG + Intergenic
1055244405 9:74222168-74222190 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1055709113 9:79039208-79039230 CCCAGTCATGCCTTTTCTCCTGG + Intergenic
1056082261 9:83107777-83107799 AATATTCCTGCCTCTTCTTGTGG + Intergenic
1058096710 9:100869835-100869857 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1058224236 9:102340232-102340254 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
1059485326 9:114622523-114622545 GCCATTCCTCCCTGGTCTTGAGG + Intronic
1059616030 9:115951557-115951579 GTCCTTCCTGCCTCTTCTTGAGG - Intergenic
1060908348 9:127328381-127328403 CCAATTCCAGCCTATTCTAGTGG + Intronic
1060961342 9:127682956-127682978 CCCATTCCTGCCTGGGCATGAGG - Intronic
1061178022 9:129009071-129009093 CCCATTCCTGCCCCACCTTGCGG + Intronic
1062460504 9:136660792-136660814 ACCCTTCCTTCCTCTTCTTGGGG - Intronic
1203443943 Un_GL000219v1:37002-37024 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1203447204 Un_GL000219v1:68471-68493 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
1203514751 Un_KI270741v1:155911-155933 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1185612022 X:1398596-1398618 CCCATGCCGGCCTCTTCCTGGGG + Intergenic
1186278665 X:7968503-7968525 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1186929414 X:14372114-14372136 ATCTTTCCTGCCTTCTCTTGTGG - Intergenic
1187075457 X:15930021-15930043 CCCACTCATGCCTTTCCATGTGG + Intergenic
1187222782 X:17345588-17345610 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
1187248090 X:17571775-17571797 ATCATTCCTGCTTTCTCTTGTGG + Intronic
1187837254 X:23445438-23445460 CCCAATACAGCCTTTTTTTGTGG - Intergenic
1187862273 X:23694016-23694038 TCCATCCCTGATTTTTCTTGTGG - Intergenic
1188288983 X:28365193-28365215 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1189315473 X:40052960-40052982 CCCATTTCTCCCCTTTCTGGGGG + Intronic
1190222364 X:48520656-48520678 CCCCTTCCTGCCTTGTGGTGGGG - Exonic
1190319841 X:49173540-49173562 ACCATTTCTGCCTTTGCTTCTGG + Intronic
1191124215 X:56937268-56937290 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1191165159 X:57382208-57382230 ATCATTCCTGCTTTCTCTTGTGG - Intronic
1191765396 X:64693077-64693099 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
1191798952 X:65056198-65056220 ATCTTTCCTGCTTTTTCTTGTGG + Intergenic
1191876211 X:65799510-65799532 ATCTTTCCTGCCTTCTCTTGTGG - Intergenic
1192020856 X:67389214-67389236 AGCATTCCTGCTTTTTCTTGTGG - Intergenic
1192683989 X:73284373-73284395 ACCTTTCCTGCTTTGTCTTGTGG - Intergenic
1193081263 X:77408888-77408910 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
1193419630 X:81268328-81268350 ACCTTTCCTGTTTTTTCTTGTGG + Intronic
1193733590 X:85130755-85130777 ATCTTTCCTGCCTTCTCTTGTGG + Intergenic
1193744705 X:85262160-85262182 TCCATTTCTACCTTTTCTTAAGG - Intronic
1194342179 X:92718544-92718566 GCCTTTCCTGCTTTCTCTTGTGG - Intergenic
1195340310 X:103900226-103900248 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
1196075897 X:111575725-111575747 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1196550448 X:117017779-117017801 CTCATCCCTCCCTTTTCCTGGGG - Intergenic
1197990981 X:132316982-132317004 CACTTTCCTGCTTTCTCTTGTGG + Intergenic
1198172423 X:134120194-134120216 CTCTTTCCTGCTTTCTCTTGTGG - Intergenic
1198335539 X:135662623-135662645 CTCTTTCCTGCTTTCTCTTGTGG + Intergenic
1198663767 X:138999218-138999240 ATCTTTCCTGCTTTTTCTTGTGG - Intronic
1199563884 X:149193926-149193948 ACCGTTCCTGCTTTCTCTTGTGG - Intergenic
1200074583 X:153544785-153544807 CCCACTCCTGTCTCTTCTGGCGG + Intronic
1200650537 Y:5835240-5835262 GCCTTTCCTGCTTTCTCTTGTGG - Intergenic
1201249536 Y:12042389-12042411 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1201588491 Y:15588102-15588124 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic
1202022498 Y:20480088-20480110 ATCTTTCCTGCTTTTTCTTGTGG - Intergenic
1202066617 Y:20947241-20947263 ATCATTCCTGCTTTCTCTTGTGG + Intergenic
1202351592 Y:23998009-23998031 ACCTTTCCTGCTTTCTCTTGTGG - Intergenic
1202519187 Y:25672110-25672132 ACCTTTCCTGCTTTCTCTTGTGG + Intergenic