ID: 1047345341

View in Genome Browser
Species Human (GRCh38)
Location 8:124022463-124022485
Sequence CAAGTGGCCCATTATGTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047345341 Original CRISPR CAAGTGGCCCATTATGTTAT GGG (reversed) Intronic
904866872 1:33586378-33586400 CAAGTGACCTTTCATGTTATGGG + Intronic
909523446 1:76595835-76595857 CAAGTGGGCCATTATTTGGTGGG - Intronic
910893337 1:92041010-92041032 AAAGTGACTCACTATGTTATGGG - Intronic
1064950538 10:20844610-20844632 AAAGTGCACCATTATGTTTTTGG + Intronic
1065108088 10:22410895-22410917 GATTTGGCTCATTATGTTATAGG + Intronic
1067197722 10:44136900-44136922 CAAGATGCCCATTCTCTTATAGG + Intergenic
1070011753 10:72482230-72482252 CAAATGACTCATTAGGTTATTGG - Intronic
1074280392 10:112045980-112046002 GAAGTGTCCCATTATTTTAAAGG - Intergenic
1078648035 11:13160415-13160437 CAAGTGGCTCATCATTTTACAGG - Intergenic
1080700121 11:34637548-34637570 CCAGTGGCCCATAATTTTAGGGG + Intronic
1085860069 11:80222776-80222798 CAAGTGGCCAATAATGCCATTGG + Intergenic
1089812729 11:121144816-121144838 CAAGTTGCCCATAATCTTGTAGG + Intronic
1090448699 11:126787088-126787110 CAAGGGGCCAGTTATGTGATCGG + Intronic
1091132645 11:133159355-133159377 CAAGTGGCCCTAAATGTTAGAGG + Intronic
1092074627 12:5662926-5662948 CAAGTTGTCCATTATGTTTCAGG + Intronic
1107442641 13:40441757-40441779 GAATTGGCCCATTATGTCAAAGG - Intergenic
1108109061 13:47047705-47047727 CAAGGGGCCTATTGTGTTTTAGG - Intergenic
1108392996 13:49966285-49966307 CAAGTGTACCATTATGGTATGGG + Intergenic
1110551183 13:76813153-76813175 AAAGTGGCTCATTGTGTTTTGGG - Intergenic
1125567435 15:40687599-40687621 CAAGCGGCTCATTTTGTTAATGG - Intergenic
1126390468 15:48144314-48144336 AAAGTAGTCCATCATGTTATAGG - Intronic
1126523785 15:49626908-49626930 CAAGTTTCCCATTATCTTACAGG + Intronic
1135275215 16:21106297-21106319 CAAGTGCCCCCATATGTTAGAGG - Intronic
1136641060 16:31565676-31565698 CAAGTGGCCCATTAGGTGTCTGG - Intergenic
1136663912 16:31791644-31791666 CAAGTGGCCCATTAGGTGTCTGG + Intronic
1142849842 17:2699201-2699223 CAAGTTGTCCAATATATTATAGG + Intronic
1144081461 17:11767765-11767787 TAAGGGGCCCATTATCTAATAGG + Intronic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1146050869 17:29552427-29552449 GAAGTGGCCTATTGTGTTCTGGG + Intergenic
1149230229 17:54525180-54525202 CAAGTGACCCATTGTTCTATAGG + Intergenic
1154413086 18:14152419-14152441 CAAGTTTGCCATTATCTTATAGG - Intergenic
1155449438 18:25948019-25948041 CAAGTGGTTCTTTGTGTTATTGG + Intergenic
1155997531 18:32346389-32346411 CAATTGGACCATCATTTTATGGG + Intronic
1157562989 18:48661653-48661675 CAGGTGGCCCCTAATGTTCTAGG - Intronic
1158918288 18:62159731-62159753 TTAATTGCCCATTATGTTATAGG + Intronic
1168362960 19:55758112-55758134 CATGTGGCAGATTATATTATAGG + Intergenic
1168363915 19:55768112-55768134 CATGTGGCAGATTATATTATAGG + Intergenic
930392212 2:50776031-50776053 TAAATGGCCCATTATGCTTTGGG - Intronic
934922136 2:98353029-98353051 TAATTGGCCATTTATGTTATAGG - Intronic
941499649 2:166256073-166256095 CAAGTTTCCCATTATGTTACAGG + Intronic
942230040 2:173852426-173852448 CAAGAGCACCACTATGTTATAGG - Intergenic
943030027 2:182674894-182674916 CAAATGGCCCATTAAATCATGGG - Intergenic
945993809 2:216418853-216418875 AAAATGGCCCATTATGATAATGG - Intronic
946388539 2:219401207-219401229 CCAGTGGCACATTGTTTTATAGG - Intergenic
1176859922 21:14005834-14005856 CAAGTTTGCCATTATCTTATAGG + Intergenic
1177486205 21:21759574-21759596 GAAGTGACACATTATGTTATAGG - Intergenic
1178508606 21:33183366-33183388 CAAGTGTCCCATTAGCTTTTTGG - Intergenic
954915406 3:54145237-54145259 TAAGTTGCCAATTATGTAATGGG + Intronic
957657354 3:83097444-83097466 CAAGTTTCCCATGCTGTTATGGG - Intergenic
963462345 3:145632849-145632871 CATGTTGCCTATTATGTTAGAGG + Intergenic
964579083 3:158210614-158210636 ATAGTGGCCCATTGTGTTGTTGG + Intronic
965699067 3:171440762-171440784 CAAATGGCACATTATGATAGGGG + Intronic
967190288 3:186978838-186978860 AAAGTGGCCCATTGTGTTCAGGG - Intronic
969574859 4:8030824-8030846 CAAGTGGCCCCTTGTGTGTTTGG + Intronic
971946187 4:33281047-33281069 CAAATGGCCAATTATCATATAGG - Intergenic
975635111 4:76440585-76440607 CAGGTGTCCCCTTATTTTATGGG - Intronic
979525342 4:121710032-121710054 CAAGTGTCCCAATATCTTAACGG + Intergenic
982150225 4:152446069-152446091 AAGGTTGGCCATTATGTTATTGG - Intronic
982648922 4:158062236-158062258 CAAGTAGACAATTATTTTATTGG - Intergenic
990689755 5:58350366-58350388 CAAGAAGCCCATCGTGTTATAGG - Intergenic
991198397 5:63961493-63961515 AACGTGGCCAATTATCTTATTGG - Exonic
996161177 5:120167275-120167297 CAAGTATCCCATTATTTTCTTGG + Intergenic
1000408011 5:160909074-160909096 TAAGTGGCCTATGATTTTATGGG + Intergenic
1002149055 5:177211668-177211690 TAAGTGGCCCATTATCTGAAGGG - Exonic
1007149105 6:39670386-39670408 AAATTGGCCATTTATGTTATTGG - Intronic
1015950028 6:138543167-138543189 CAAGTGATCCATTATGGTCTGGG - Intronic
1024398029 7:48891094-48891116 CAAGTGGCCAAGTATTTTAAAGG - Intergenic
1029299688 7:99570213-99570235 AAAGTTGCAAATTATGTTATTGG + Intronic
1037521022 8:19680916-19680938 CATATGCCCCATTATCTTATGGG + Intronic
1044421848 8:92005550-92005572 CAAGTGGCACATTATTTTTAGGG + Intronic
1044579313 8:93807747-93807769 CAAGTGCCATATTATGTTTTCGG + Intronic
1047345341 8:124022463-124022485 CAAGTGGCCCATTATGTTATGGG - Intronic
1053019258 9:34683673-34683695 GAAGAGGCCCATAATGATATTGG + Intergenic
1055194334 9:73569234-73569256 CAAATGGGCCATTATGTGGTGGG - Intergenic
1056798548 9:89675530-89675552 CAAGTGTCACAATATTTTATGGG + Intergenic
1058377538 9:104340854-104340876 CCAGAGGTCCATTATATTATAGG - Intergenic
1059250145 9:112880914-112880936 CAAAGGGCTCATGATGTTATGGG - Intronic
1186391235 X:9161676-9161698 CACGTTGCCTATTATTTTATAGG + Intronic
1186968273 X:14811701-14811723 AAAGTGTCCCATTATTATATGGG - Intergenic
1187713554 X:22078252-22078274 CATGTGGCCCATTGCTTTATGGG - Intronic
1188660158 X:32749003-32749025 CAAGTGCCCCATTAGGTCCTAGG + Intronic
1189528353 X:41851054-41851076 CAATTGGCCCTTTATGTTTATGG - Intronic
1193049914 X:77088929-77088951 TAAGTAGCCCATTCAGTTATAGG - Intergenic
1201640730 Y:16173922-16173944 CAAATCCCCTATTATGTTATGGG - Intergenic
1201662085 Y:16411404-16411426 CAAATCCCCTATTATGTTATGGG + Intergenic