ID: 1047347736

View in Genome Browser
Species Human (GRCh38)
Location 8:124044760-124044782
Sequence CCGAAGACTGGAGTTGTTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047347736_1047347740 -5 Left 1047347736 8:124044760-124044782 CCGCAAACAACTCCAGTCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1047347740 8:124044778-124044800 TTCGGCTGTGTGAAATTGGCAGG No data
1047347736_1047347739 -9 Left 1047347736 8:124044760-124044782 CCGCAAACAACTCCAGTCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1047347739 8:124044774-124044796 AGTCTTCGGCTGTGTGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047347736 Original CRISPR CCGAAGACTGGAGTTGTTTG CGG (reversed) Intronic
904768180 1:32866393-32866415 CTGCAGACTGGAGTCTTTTGAGG - Intronic
906854714 1:49292192-49292214 CCAAAGACTGGAGTGGGCTGAGG - Intronic
914411446 1:147432266-147432288 CAGAAGATTTGAGGTGTTTGTGG - Intergenic
917154480 1:171981983-171982005 CTGAAGCCTCAAGTTGTTTGAGG + Intronic
1075544549 10:123345085-123345107 CCGACGTCTTGAGTTGTCTGTGG + Intergenic
1075981291 10:126742287-126742309 CAGAAGACTTGGGATGTTTGAGG + Intergenic
1084934947 11:72581844-72581866 GCGAAGACTGGGGCTGTCTGTGG + Intronic
1091071241 11:132565590-132565612 TCGCAGACTGGGGTGGTTTGAGG - Intronic
1091576105 12:1737308-1737330 GAGAAGACTGAAGTTATTTGTGG + Intronic
1099562728 12:84198180-84198202 CCACACACTGGAGTTTTTTGGGG + Intergenic
1100666000 12:96754040-96754062 CCTAAGACTGGATTTGGTGGAGG - Intronic
1106629588 13:31456977-31456999 CAGAAGGCTGGAGGTATTTGGGG + Intergenic
1109685617 13:65815654-65815676 CCTAAATCAGGAGTTGTTTGTGG + Intergenic
1115151799 14:30294486-30294508 TAGAAGTCTGAAGTTGTTTGGGG + Intergenic
1118893731 14:69929251-69929273 CCTCAGACTGAAATTGTTTGGGG - Intronic
1120352175 14:83376370-83376392 CCTAAGAATAAAGTTGTTTGGGG + Intergenic
1121032175 14:90667522-90667544 GAGAAGAATGGGGTTGTTTGCGG - Intronic
1121299917 14:92862131-92862153 ACCAAGACTGGAGTTGCTGGAGG + Intergenic
1125746050 15:41997923-41997945 CAGGAGCCTGGACTTGTTTGGGG - Intronic
1126087973 15:45026604-45026626 CCTATGAAGGGAGTTGTTTGGGG + Intronic
1126350041 15:47735797-47735819 ACTTACACTGGAGTTGTTTGTGG - Intronic
1128146585 15:65335322-65335344 CCGGATACTGGCGATGTTTGAGG + Exonic
1131295432 15:91144245-91144267 CACAGGACTGGAGTGGTTTGAGG + Intronic
1133852604 16:9519831-9519853 ACGAACACTTGAGTTGTTTCCGG - Intergenic
1136010778 16:27362429-27362451 GCGATGTGTGGAGTTGTTTGAGG + Exonic
1141024680 16:80534688-80534710 CAGCAGACTGGAGATGTTAGAGG - Intergenic
1142126787 16:88414434-88414456 CCGCAGACTCGAGTTGTTGGAGG + Intergenic
1144416274 17:15050344-15050366 CCCAGGACTGGGTTTGTTTGGGG - Intergenic
1146032233 17:29376160-29376182 GGGAAGGCTGGGGTTGTTTGGGG + Intergenic
1148677868 17:49455543-49455565 CCGAAGCCAGGAGTTGTGTGTGG + Intronic
1150986870 17:70208107-70208129 AAGAAGACTGCAGTGGTTTGTGG + Intergenic
1152063527 17:78096964-78096986 CCTAGGACTGTAGTTTTTTGAGG - Intronic
1156817295 18:41326578-41326600 CTGAATACTGGAATTCTTTGTGG + Intergenic
1157494102 18:48142930-48142952 CCAAAGCCTGGAGTGGTGTGGGG - Intronic
1163020698 19:14479615-14479637 CAGAAGCCTGGAGAAGTTTGGGG - Intronic
1166636877 19:44458403-44458425 CTGAAATCTGGGGTTGTTTGGGG + Intergenic
928001358 2:27525544-27525566 CTGAAGACTGGATTAGATTGTGG + Intergenic
928980732 2:37133088-37133110 CTGAAGACTGGGGTTGATAGGGG - Intronic
931156482 2:59637626-59637648 CCAAAGAGTGGAGTTGTTTTAGG + Intergenic
935229032 2:101079984-101080006 CCTAAGACTGGACCTGGTTGGGG - Intronic
935653864 2:105404906-105404928 CGGAATCATGGAGTTGTTTGTGG - Intronic
936029292 2:109058731-109058753 CAGAAGAGTGGAATTGATTGGGG + Intergenic
937271645 2:120656615-120656637 CCTAGGAATGGGGTTGTTTGAGG + Intergenic
939393994 2:141605173-141605195 CTGCAGACTGGATTTGCTTGTGG - Intronic
942701700 2:178718782-178718804 CACAGAACTGGAGTTGTTTGAGG - Exonic
942861041 2:180612583-180612605 CCGAAGACTTCAGTTGCTTCAGG - Intergenic
944540390 2:200748656-200748678 CCCAAGTATGGACTTGTTTGGGG - Intergenic
946369630 2:219272765-219272787 CCTGACACTGGAGTTGGTTGAGG + Intronic
950604056 3:14062462-14062484 CTTAAGACTGGAGGTATTTGGGG + Intronic
950943891 3:16924432-16924454 ACAAAGACTAGAGTTGTTTCTGG - Intronic
957463070 3:80547776-80547798 CCTAAGATTAGAGTGGTTTGTGG + Intergenic
973180314 4:47259189-47259211 GTGAAGGCTGGATTTGTTTGTGG - Intronic
974940519 4:68462238-68462260 CCAATGTCTTGAGTTGTTTGAGG + Intronic
980743456 4:136982306-136982328 CCGAAGACTGCAGATGTTCTTGG + Intergenic
981072104 4:140553474-140553496 ATGATGACTGGAGGTGTTTGGGG + Exonic
986468123 5:8047430-8047452 CCAAAGCCTGAAGTTGTTTATGG - Intergenic
997747509 5:136311929-136311951 CTGAAGCCTGGAGATATTTGAGG + Intronic
1001215849 5:169855046-169855068 GTGAAGGCTGGAGTTCTTTGAGG - Intronic
1001422915 5:171600699-171600721 CAGAAGGCTGGAGAGGTTTGGGG - Intergenic
1008179170 6:48306393-48306415 CTGTAGTCTGGAGTAGTTTGAGG - Intergenic
1010225156 6:73482050-73482072 CCGAAGACTGGCGTTGATTCCGG - Exonic
1010829284 6:80510751-80510773 CAGAAGATAGGAGTTTTTTGAGG + Intergenic
1011722877 6:90177160-90177182 GAGCAGACTGCAGTTGTTTGAGG - Intronic
1014496709 6:122133363-122133385 CCCAAGACTCGGGTTGTTTCTGG - Intergenic
1027910860 7:84248697-84248719 TCAAAGAGTGGAGTTGTTTTAGG - Intronic
1030007786 7:105135482-105135504 CCTATGATTTGAGTTGTTTGTGG - Intronic
1033638521 7:143237560-143237582 ACTTAGACTGTAGTTGTTTGTGG + Intergenic
1033995446 7:147340368-147340390 CCTATGATTGGAGTTGCTTGGGG - Intronic
1038133292 8:24758425-24758447 GCGAAGACTGCAGGTGTCTGTGG - Intergenic
1040984286 8:53277021-53277043 CCCAAGTCTGTATTTGTTTGGGG + Intergenic
1041135351 8:54752196-54752218 CAGAAGATTGGAGATGTTTTTGG - Intergenic
1042364044 8:67916097-67916119 CTTAAGACTGGAGATGTTTTGGG - Intergenic
1043394686 8:79825126-79825148 CCTAACACTGGATTTGTTTAAGG + Intergenic
1047347736 8:124044760-124044782 CCGAAGACTGGAGTTGTTTGCGG - Intronic
1047560518 8:125982971-125982993 GCAAAGACAGCAGTTGTTTGGGG + Intergenic
1047939594 8:129816295-129816317 CTGAACACTGCAGTTGGTTGTGG - Intergenic
1053170179 9:35872961-35872983 CCTAAGACTGGAGGAGGTTGAGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1185789922 X:2920969-2920991 CCAATGTCTGGAGATGTTTGTGG + Intronic
1190966522 X:55306117-55306139 CTGCAGACTGGAGCTGTTTCTGG + Intergenic
1190969468 X:55334710-55334732 CCAAAACCTGGAGTTGTGTGGGG + Intergenic
1194382293 X:93209289-93209311 CAGAAGGCTGGAGTGGTTGGTGG + Intergenic
1196556049 X:117085858-117085880 CAAAAGACTAGAGTTGTTTGTGG + Intergenic
1197143172 X:123139357-123139379 CTGAATACTGCAGTTGTTGGCGG - Intergenic
1199532499 X:148866174-148866196 GCGAAGACTGTCTTTGTTTGGGG - Intronic