ID: 1047348734

View in Genome Browser
Species Human (GRCh38)
Location 8:124053349-124053371
Sequence CAGTGCTTACTTTATTAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047348734_1047348736 12 Left 1047348734 8:124053349-124053371 CCGACTTAATAAAGTAAGCACTG 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1047348736 8:124053384-124053406 AGCCTGAGATACAATTCATTAGG No data
1047348734_1047348738 23 Left 1047348734 8:124053349-124053371 CCGACTTAATAAAGTAAGCACTG 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1047348738 8:124053395-124053417 CAATTCATTAGGATTTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047348734 Original CRISPR CAGTGCTTACTTTATTAAGT CGG (reversed) Intronic
906050226 1:42864797-42864819 CAGTGATTATTTCATTAAGTAGG - Intergenic
906763126 1:48397741-48397763 GATTGCTTACATTATTAAATAGG - Intronic
908089718 1:60673223-60673245 CATTGCTTCATTTATTAAATAGG - Intergenic
909526734 1:76633022-76633044 CAGTGCTAGCCTTTTTAAGTAGG + Exonic
912850395 1:113119106-113119128 GAGCACTTACTTTATAAAGTAGG - Intronic
913145706 1:115987876-115987898 CAATGTTTATTTTTTTAAGTAGG - Intronic
913157320 1:116112651-116112673 CTGTCCTTACCTTATTCAGTAGG - Exonic
915997600 1:160579776-160579798 CAATGCTTACTACATTAAATTGG - Intergenic
916243855 1:162667227-162667249 CAGTACTTACTTTAGTAATAAGG + Intronic
916527391 1:165624020-165624042 CAGTGGAAACTTTATTAAGTTGG + Intergenic
917583537 1:176400717-176400739 CATTGCTGATTTTATTTAGTTGG + Intergenic
917990437 1:180371378-180371400 CAGTGCTTCCTATCTCAAGTAGG - Intronic
918748678 1:188241961-188241983 CAGCTCTTACTTTTTTAATTAGG - Intergenic
918923386 1:190745862-190745884 AAGTGCTTAAATAATTAAGTAGG + Intergenic
919015775 1:192033340-192033362 CAGTAATTACTCTATGAAGTTGG - Intergenic
921694836 1:218196594-218196616 CAGTGTTTACCTTTTTTAGTTGG - Intergenic
924683739 1:246265799-246265821 CAGTGCTTGCTTTTTAAAGTAGG + Intronic
1063243934 10:4199183-4199205 CAGTGTTAATTTTCTTAAGTGGG - Intergenic
1077596415 11:3535805-3535827 CAGTTATTATTTTATTAAATAGG - Intergenic
1078278891 11:9879446-9879468 CAGGGCATACTTGATTATGTTGG - Intronic
1078678649 11:13452869-13452891 CAATGCTTACTGTCTTTAGTAGG + Intronic
1078784128 11:14471307-14471329 CAGTGCAAACATTATTAACTCGG + Intronic
1081223738 11:40495674-40495696 CAGTACTTGATTTAATAAGTTGG + Intronic
1083454917 11:62772067-62772089 CAGTGCTTACTTCATGATCTTGG + Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1084252328 11:67909782-67909804 CAGTTATTATTTTATTAAATAGG - Intergenic
1085543059 11:77289979-77290001 CAGTGATTATTTTATTAAATTGG - Intronic
1086478528 11:87207657-87207679 CAGTGTTAAATTTATTAAATGGG - Intronic
1090122346 11:124044483-124044505 CAATACTTACTTTTTTAATTTGG - Intergenic
1090949184 11:131457791-131457813 CAGTGATTAGTTTATGAAGATGG + Intronic
1091897411 12:4116663-4116685 CAATGCTCTTTTTATTAAGTTGG - Intergenic
1092422587 12:8344575-8344597 CAGTTATTATTTTATTAAATAGG - Intergenic
1092514974 12:9201657-9201679 TACTGCTTACTTTCATAAGTTGG + Intronic
1093642947 12:21549197-21549219 CAGTGATAACTGTAGTAAGTGGG - Intronic
1096026602 12:48369661-48369683 CAGCTGTTACTTTATTAAATAGG - Intergenic
1096340957 12:50798614-50798636 CTGAGATTTCTTTATTAAGTAGG + Intronic
1097818498 12:64102159-64102181 CAATGCTTTATTTATTAGGTTGG + Intronic
1099174854 12:79409041-79409063 AACTGCTTGCTTTATTAAGACGG - Intronic
1103495387 12:121358107-121358129 CCGTGCTTCCTTTATTACCTTGG - Intronic
1109785005 13:67161904-67161926 CAGTTATCACTTTAGTAAGTTGG - Intronic
1114413469 14:22521945-22521967 CAGTGCTTCCTTTATGAATTAGG - Intergenic
1114593027 14:23886016-23886038 AATAGCTTTCTTTATTAAGTTGG + Intergenic
1117105573 14:52394515-52394537 CAGTGGGTACCTTATTGAGTTGG - Intergenic
1117526217 14:56608316-56608338 TACTGCTTACTTTAGTAACTGGG - Intronic
1118337016 14:64862131-64862153 CAGTGTTAACTGTGTTAAGTGGG - Intronic
1118505007 14:66401721-66401743 CAGTGCCTAATTTATCAACTTGG + Intergenic
1119584524 14:75820739-75820761 CAGTGGTTTCTTTTTTAATTTGG - Intronic
1120566609 14:86066986-86067008 CAGTGCTTATTTTTATATGTAGG - Intergenic
1121597566 14:95177235-95177257 TAGTGCTTGCTTTATTTATTGGG + Intergenic
1129336611 15:74855779-74855801 CAGTACTGATTTTATTAAATCGG + Intronic
1131680761 15:94720502-94720524 CAGTCCTTACTCTTTCAAGTAGG - Intergenic
1133375687 16:5285026-5285048 CAGTTATTATTTTATTAAATAGG + Intergenic
1137691178 16:50429127-50429149 AAGTGTTTACCTTGTTAAGTGGG - Intergenic
1138926460 16:61597550-61597572 CAGTTCTGACATTAGTAAGTGGG - Intergenic
1140548193 16:75833046-75833068 CAGTTTTGACTTTTTTAAGTTGG + Intergenic
1144659273 17:17057959-17057981 CAGTGTTCTCTTTCTTAAGTTGG - Intronic
1146080521 17:29776134-29776156 AAGTTCTTACTTTATTTACTTGG - Intronic
1147490897 17:40865057-40865079 CAATGCTGCCATTATTAAGTAGG - Intronic
1149130710 17:53297503-53297525 CAGTTATTATTTTATTAACTAGG - Intergenic
1149466352 17:56882800-56882822 CAGTGAGTAGTTTATAAAGTGGG + Intergenic
1151159650 17:72154303-72154325 TAGTGCTTACTGTATTAGTTAGG + Intergenic
1155722170 18:29029190-29029212 CAGTGTTTTCTTTATAAAATAGG + Intergenic
925095544 2:1196450-1196472 CAGGTCTTACTTTATTAAATAGG - Intronic
925864005 2:8208675-8208697 CAGTGCTTACATTACAAAGCAGG + Intergenic
926295285 2:11564573-11564595 CAGTGTTTACTGTATTTATTTGG - Intronic
929060229 2:37916335-37916357 CATTATTTACTTTATTTAGTCGG - Intergenic
929431019 2:41886646-41886668 CAGTGTTTTCTTTATTATTTAGG - Intergenic
930525924 2:52529675-52529697 ATGTTCTTACTTTATAAAGTGGG + Intergenic
932658725 2:73633564-73633586 CATTGCATTCTTTATTAAATAGG - Intergenic
933540161 2:83630027-83630049 CTTTACTTACTTTTTTAAGTTGG + Intergenic
935640493 2:105285453-105285475 CAATTCTTACTTTAGTAAGTTGG - Intronic
935705638 2:105854964-105854986 CAGTGCCTAATTTTTCAAGTTGG + Intronic
940527478 2:154835150-154835172 CAGTCATTACTTCATTAAGTAGG + Intronic
941529877 2:166654920-166654942 CAGTGGCTATTTTATTAGGTAGG + Intergenic
943034432 2:182724131-182724153 CAATCCTTACTGTATTATGTAGG - Intronic
943034715 2:182728057-182728079 CAATCCTTACTGTATTATGTAGG + Intronic
945144774 2:206726778-206726800 CTGTGTATACTTAATTAAGTTGG + Intergenic
945230666 2:207585945-207585967 CAGTGATTATTTTGTTAAATAGG - Intronic
945519636 2:210809001-210809023 GACTGCTTAATTTGTTAAGTAGG + Intergenic
945698494 2:213140208-213140230 CAGCGCTTACATTTTTAAGATGG + Intronic
947698398 2:232212123-232212145 CAGTACTTGCTTTTTGAAGTAGG - Intronic
948871532 2:240801625-240801647 AAGTGATGACTTTAGTAAGTGGG + Intronic
1170115054 20:12848931-12848953 CAGTGCCTAGTTTATTAAGGGGG - Intergenic
1179055383 21:37927277-37927299 CATTGCTTTCTATTTTAAGTGGG + Intergenic
1182596944 22:31428963-31428985 CATTGATTACTTGGTTAAGTTGG + Intronic
952232910 3:31449754-31449776 CATTTATTACTTTGTTAAGTAGG - Intergenic
953763031 3:45708200-45708222 CAGTCTTTACTTTGTAAAGTGGG - Intronic
954961117 3:54565830-54565852 TAGTTCTTACTTTATAAAATGGG + Intronic
955422216 3:58750149-58750171 CTGTCCCTACTTTATTCAGTAGG - Intronic
957241694 3:77668649-77668671 CAGGGCTTCCTGTAATAAGTGGG + Intergenic
958070664 3:88606774-88606796 CAGTTTTGTCTTTATTAAGTTGG + Intergenic
958989305 3:100823940-100823962 CAATGATTACTTTTTTATGTCGG - Intronic
960164232 3:114383810-114383832 CAGTTCATAGTTTATTAAGGAGG + Intronic
961286760 3:125811860-125811882 CAGTTATTATTTTATTAAATGGG + Intergenic
961974752 3:131011768-131011790 AAGAGATTATTTTATTAAGTTGG - Intronic
963150189 3:142037690-142037712 CAGTCCTTACTTTCTTATCTGGG + Intronic
963437243 3:145287433-145287455 TAGCTCTTACTTTATTAGGTAGG + Intergenic
966850664 3:184163252-184163274 CTGTCCTTCCTTTCTTAAGTGGG - Intronic
967628855 3:191718818-191718840 TAGTTCTTATTTTTTTAAGTAGG - Intergenic
969802459 4:9579732-9579754 CAGTTATTATTTTATTAAATAGG + Intergenic
970660871 4:18284373-18284395 CATAGCTTATTTTATTAAGTAGG + Intergenic
972088846 4:35255342-35255364 CAGTGCATTCTTTAATAATTTGG - Intergenic
974315892 4:60280920-60280942 CAGCAATTATTTTATTAAGTAGG + Intergenic
977392969 4:96436536-96436558 CAGTGTTTAATTTTTAAAGTTGG - Intergenic
977803541 4:101268359-101268381 CAGTGATTACATTCTTAAGCTGG + Intronic
980671470 4:136012991-136013013 CCATGCTTACTTTATGAAGGTGG + Intergenic
980880402 4:138704389-138704411 CAGTTCTTACTCTGTAAAGTGGG - Intergenic
981254522 4:142645812-142645834 CAATGCTTACAGTATTAATTAGG - Intronic
981913643 4:150010481-150010503 CGGTGCTTGCATTTTTAAGTGGG - Intergenic
982822816 4:159965700-159965722 CAGTTATTATTTTATTAAATAGG + Intergenic
983710268 4:170706581-170706603 CAGTGCTTACTTTTATAAGCTGG - Intergenic
984563594 4:181300770-181300792 AATTGCTTAATTTTTTAAGTTGG + Intergenic
986541454 5:8848842-8848864 CACTGCTTTCTTTAGAAAGTAGG - Intergenic
987126907 5:14821694-14821716 CAGTGCTTTCTTTAGTTAGCAGG - Intronic
990685647 5:58297768-58297790 CAGACCTTATTTTATTATGTAGG - Intergenic
990812410 5:59743097-59743119 CAGTGATTATTCTATAAAGTGGG + Intronic
993713956 5:91256073-91256095 CAGTCCTTATTTTCTTCAGTTGG - Intergenic
996867720 5:128146228-128146250 CAGTGTTTAATTTCTTAAGTAGG - Intronic
997500218 5:134367953-134367975 GAGTGCTTTCTTTATTGAATAGG + Intronic
1000451866 5:161399510-161399532 CAGTGACTACTTTATTAAGCAGG + Intronic
1004385149 6:15166297-15166319 CAGTGCTTCCGTTAATTAGTAGG + Intergenic
1004857083 6:19762248-19762270 CAGTCCTTCCTTTCTAAAGTGGG + Intergenic
1010746759 6:79571613-79571635 CAGTGTTTAATTTCTTAGGTTGG - Intergenic
1013340696 6:109212698-109212720 CAGTGATTATTTTATTATGTAGG + Intergenic
1013660471 6:112290787-112290809 CAGTCCATACTTTATTACGACGG - Intergenic
1013946233 6:115726221-115726243 CAGTAATTACTTTATAAATTTGG + Intergenic
1014525572 6:122497703-122497725 AAGTACTTATTTTATTAATTTGG - Intronic
1015569090 6:134603747-134603769 CAGTGCTTATTGCACTAAGTTGG - Intergenic
1015946199 6:138503925-138503947 CAGTTTTTACTTTTTTAACTGGG - Intronic
1016754430 6:147668483-147668505 CTGTGGTTACTTTATTATGGTGG - Intronic
1021295703 7:18903706-18903728 CAGGGCTTACTTTAGGATGTAGG - Intronic
1021398653 7:20183139-20183161 AAGGGCCTACTTCATTAAGTCGG - Intronic
1021413196 7:20351878-20351900 CAGTGCTTTTTTTTTTAAGTTGG + Intronic
1023501014 7:40849563-40849585 AAGTGTTTACATTATTAAGTTGG + Intronic
1027531973 7:79346223-79346245 AAGTGATTTCTTAATTAAGTAGG - Intronic
1028012104 7:85658399-85658421 CACTGCATAATTTATTAAATAGG - Intergenic
1029070276 7:97890273-97890295 CAGTTATTATTTTATTAAATAGG - Intergenic
1032146636 7:129388549-129388571 CAGAGCTTTCTTTTTTAAGACGG - Intronic
1036248287 8:7139428-7139450 CAGTTATTATTTTATTAAATAGG + Intergenic
1036252526 8:7174925-7174947 CAGTTATTATTTTATTAAATAGG - Intergenic
1036364971 8:8112537-8112559 CAGTTATTATTTTATTAAATAGG + Intergenic
1038060609 8:23908022-23908044 GAGGGCTTGCTTTATTAGGTTGG + Intergenic
1038952497 8:32431295-32431317 CAGTGCTTACTCTAGCAAATAGG + Intronic
1041530710 8:58863365-58863387 CCGTGCTTAGTATATTAGGTGGG - Intronic
1044592035 8:93922647-93922669 CAATGATTACTTTAGTAAGGAGG + Exonic
1045692880 8:104777788-104777810 CAGTGCTTTATTTTTTAAGCAGG + Intronic
1046271991 8:111908581-111908603 CAGTGCTTACATTTTTATCTGGG + Intergenic
1046515240 8:115250938-115250960 CAAAGCTTACCTTATTAAATAGG - Intergenic
1046596395 8:116266314-116266336 CAGGGCTTAATTTGTCAAGTAGG - Intergenic
1047348734 8:124053349-124053371 CAGTGCTTACTTTATTAAGTCGG - Intronic
1047543102 8:125789811-125789833 CTGTGCTGACTTTATTAAACGGG + Intergenic
1048702411 8:137107525-137107547 CAGTTCTTTCTTTAATAACTGGG - Intergenic
1050249793 9:3732784-3732806 CAGTGCTTAGTTTATTCACCAGG + Intergenic
1052192568 9:25677164-25677186 CAGTGTTTGCTTTTATAAGTCGG - Exonic
1052710319 9:32047439-32047461 CAGTTCTGATTTTATTGAGTTGG - Intergenic
1055865226 9:80805235-80805257 AAGGGCTTACTTTATAAATTGGG - Intergenic
1056287878 9:85109628-85109650 CACTGTTTCCTTTATTTAGTTGG + Intergenic
1058197581 9:101997663-101997685 AAGTGATTACTTTAATAAATGGG + Intergenic
1060003396 9:119978699-119978721 CAGTGCTACCTTTATTAATATGG - Intergenic
1187512789 X:19937234-19937256 CATTTCTTACTTGATTTAGTAGG - Intronic
1190517346 X:51237332-51237354 CAGTTATTATTTTATTAAATTGG - Intergenic
1190924787 X:54893596-54893618 CATTTCTTACATTCTTAAGTTGG - Intergenic
1193178049 X:78418587-78418609 GGGTGCTAACTTTATTCAGTGGG + Intergenic
1194037575 X:88897090-88897112 AAATGCTTACTTTTTTAAGATGG - Intergenic
1194969677 X:100329375-100329397 CTGTGAGTACTCTATTAAGTTGG - Intronic
1196917929 X:120558159-120558181 CAGTGGTTACTTTAATGATTAGG - Intronic
1201450337 Y:14104614-14104636 CAGGGCTTGCCTTATTAATTTGG - Intergenic