ID: 1047349528

View in Genome Browser
Species Human (GRCh38)
Location 8:124060430-124060452
Sequence GAACCACGCTGTGTTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047349528_1047349536 24 Left 1047349528 8:124060430-124060452 CCTGGAGGAACACAGCGTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1047349536 8:124060477-124060499 ACACAGAGCCAGGGCAGGTGTGG 0: 1
1: 1
2: 6
3: 75
4: 642
1047349528_1047349534 19 Left 1047349528 8:124060430-124060452 CCTGGAGGAACACAGCGTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1047349534 8:124060472-124060494 TTTCCACACAGAGCCAGGGCAGG 0: 1
1: 0
2: 7
3: 27
4: 319
1047349528_1047349538 26 Left 1047349528 8:124060430-124060452 CCTGGAGGAACACAGCGTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1047349538 8:124060479-124060501 ACAGAGCCAGGGCAGGTGTGGGG 0: 1
1: 0
2: 6
3: 64
4: 524
1047349528_1047349537 25 Left 1047349528 8:124060430-124060452 CCTGGAGGAACACAGCGTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1047349537 8:124060478-124060500 CACAGAGCCAGGGCAGGTGTGGG 0: 1
1: 1
2: 5
3: 55
4: 511
1047349528_1047349533 15 Left 1047349528 8:124060430-124060452 CCTGGAGGAACACAGCGTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1047349533 8:124060468-124060490 AACTTTTCCACACAGAGCCAGGG 0: 1
1: 0
2: 1
3: 17
4: 184
1047349528_1047349532 14 Left 1047349528 8:124060430-124060452 CCTGGAGGAACACAGCGTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1047349532 8:124060467-124060489 TAACTTTTCCACACAGAGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047349528 Original CRISPR GAACCACGCTGTGTTCCTCC AGG (reversed) Intronic
902839344 1:19065354-19065376 GAACCACCCCGTCCTCCTCCCGG - Intergenic
905440030 1:37989763-37989785 GAACCTCCCTGCCTTCCTCCGGG - Intronic
911200603 1:95039814-95039836 GCTCCAGGCTGTGTTTCTCCAGG - Intronic
1064107566 10:12512975-12512997 CATCCCCACTGTGTTCCTCCAGG - Intronic
1066061654 10:31728836-31728858 CAACAAGGCTGTGTTCCTTCTGG - Intergenic
1070551021 10:77490918-77490940 GAACCACTCTTTGTAACTCCAGG + Intronic
1071421702 10:85506498-85506520 AAACCAAGCTGTGCTCCTTCTGG - Intergenic
1073482065 10:103792137-103792159 GAACCCCTATGTGTTCCTTCAGG + Intronic
1073486088 10:103819989-103820011 GAAGCACCCTGTGCCCCTCCAGG - Intronic
1075399847 10:122152879-122152901 GAGCCACTCTGTGATGCTCCAGG - Intronic
1077232735 11:1465350-1465372 GAATCAAGGTGTGCTCCTCCTGG + Intergenic
1077418035 11:2434803-2434825 CAGCCAGGCTGTGGTCCTCCTGG - Intergenic
1080624900 11:34019881-34019903 GAACCAGGCTGTATTCCAACTGG + Intergenic
1083636943 11:64125886-64125908 GAAGCCCGATGAGTTCCTCCAGG - Intronic
1091445010 12:540000-540022 TCACCCTGCTGTGTTCCTCCGGG + Intronic
1092233150 12:6789053-6789075 TAACCAGGCTCTGTTCCTCTAGG - Intronic
1092787950 12:12046500-12046522 GATCTAGGCTGGGTTCCTCCAGG + Intergenic
1095454433 12:42367758-42367780 GAGTCTCGCTCTGTTCCTCCAGG + Intronic
1099665016 12:85617483-85617505 GAACCAGGCTGTTTGGCTCCAGG + Intergenic
1103683897 12:122716152-122716174 GCACGAAGCTATGTTCCTCCTGG - Exonic
1106244782 13:27939904-27939926 GAGCCAGGCCGTGTTTCTCCCGG + Intergenic
1107173783 13:37376690-37376712 CAACAAAGCTGTGTTCCTTCAGG - Intergenic
1107651805 13:42552546-42552568 GAAGTTCCCTGTGTTCCTCCCGG + Intergenic
1112552039 13:100430484-100430506 CATCCTCTCTGTGTTCCTCCAGG + Intronic
1113709789 13:112455616-112455638 GAAGCTCGCTGTGCTCCCCCAGG - Intergenic
1118236254 14:64008010-64008032 AAATCAAGCTGTGTTCCTTCTGG + Intronic
1118322332 14:64760406-64760428 GAGCCAGGTTGTGTTTCTCCTGG - Intronic
1124364164 15:29060501-29060523 GAACTGTGCAGTGTTCCTCCTGG + Intronic
1127203245 15:56681877-56681899 GAACCACTCTGTGTTTGTTCAGG - Intronic
1127416279 15:58760411-58760433 TAACCAAGCTATTTTCCTCCTGG + Intergenic
1127859198 15:62978984-62979006 GAACCCCGCTCTTATCCTCCAGG + Intergenic
1128773560 15:70301766-70301788 GAGCCAAGCTGTGCCCCTCCAGG + Intergenic
1129703769 15:77782984-77783006 CAGCCACACTGTCTTCCTCCTGG + Intronic
1131532446 15:93205291-93205313 CAACAAGGCTGTGTTCCTCCTGG - Intergenic
1133587532 16:7210344-7210366 GGACCACACTGTGGTCCTCAAGG + Intronic
1134214156 16:12303278-12303300 GAACATGGCTGTGTTTCTCCTGG - Intronic
1135297879 16:21299219-21299241 GAACCAGGATGTTTTCCTCCCGG - Intronic
1138951343 16:61917171-61917193 GAATGCCGCTGTGTTCCTGCTGG + Intronic
1139078678 16:63486805-63486827 CCACCACGCAGTGTTTCTCCTGG + Intergenic
1151599247 17:75096263-75096285 GAAACACCCTGTGTCCCGCCCGG + Intronic
1151840751 17:76615600-76615622 AAACAGAGCTGTGTTCCTCCAGG - Intergenic
1155178325 18:23321150-23321172 TAACCAAGCTGTTTTCCTCATGG - Intronic
1158938265 18:62384604-62384626 GAACCACACTGTAACCCTCCAGG - Intronic
1160724483 19:611551-611573 GAACCGCAGTGTGTGCCTCCTGG - Intronic
1161836904 19:6653975-6653997 GTAGGACGCTATGTTCCTCCTGG - Intergenic
1164388061 19:27793844-27793866 GCACCGCGCTGTCTCCCTCCAGG - Intergenic
925010512 2:481718-481740 GAAGAACCCTGGGTTCCTCCTGG + Intergenic
925530211 2:4850936-4850958 GGACCCAGCTGTGTTCCACCAGG - Intergenic
929781489 2:44960043-44960065 GCAGCATGCAGTGTTCCTCCAGG - Intergenic
930029348 2:47048919-47048941 GCACCACACTTTGTGCCTCCTGG + Intronic
939005864 2:136785798-136785820 AAACCACGTTGTGTAACTCCTGG + Intronic
946353815 2:219172516-219172538 GAATCAAGCTTTGCTCCTCCAGG + Exonic
948180584 2:235976757-235976779 GAACCTCCCTGAGGTCCTCCAGG - Intronic
1173926181 20:46783133-46783155 GAACCTCTCTGTATTTCTCCAGG + Intergenic
1174785611 20:53429741-53429763 AAACCACTCTGTGTACCTTCAGG - Intronic
1179495596 21:41769488-41769510 CCACTACCCTGTGTTCCTCCTGG + Intergenic
1180921164 22:19522408-19522430 GAGCCAAGCTGTGGTACTCCAGG + Intergenic
1180997606 22:19973225-19973247 CCACCACGGTGTCTTCCTCCAGG + Exonic
1181785001 22:25220657-25220679 AAACCAGGCTGTGTTTCCCCAGG - Intronic
1183211942 22:36456564-36456586 TATCCATGCTGTGTCCCTCCTGG - Intergenic
1184151253 22:42640326-42640348 GAACCACGCAGGGTCCTTCCGGG - Exonic
949243135 3:1894568-1894590 GAACCACCCAGTGCTCCTCCTGG - Intergenic
953235558 3:41103348-41103370 GACCCAAGCTGTTTTCCTGCAGG - Intergenic
954289537 3:49642439-49642461 GACCCAGGCTGTGGTCCTCCTGG - Exonic
955702060 3:61691560-61691582 GAATCAAACTGTGTTCCTTCAGG + Intronic
958592166 3:96171714-96171736 AAACAACCCTGTTTTCCTCCTGG + Intergenic
961752670 3:129106441-129106463 CCACCATGCTGTGGTCCTCCAGG + Intronic
963038255 3:141050936-141050958 AAACCACCCTTTTTTCCTCCTGG + Intergenic
963178072 3:142322647-142322669 GAACCTCGCTCTGTTCGCCCAGG - Intronic
966375626 3:179292539-179292561 AAAGCAAGATGTGTTCCTCCAGG + Intergenic
967598562 3:191357107-191357129 GAGCCAGGGTGTGGTCCTCCAGG - Exonic
969259500 4:6024535-6024557 GAACCGTGCTGTGTTCGTCCTGG - Intergenic
969430407 4:7150631-7150653 GAACGATGCTGGGTTTCTCCCGG + Intergenic
969640359 4:8394760-8394782 GAACCACGATGTGTTCACGCAGG - Intronic
970315587 4:14825727-14825749 CAGCCATGCTGTGTTCATCCGGG - Intergenic
973611053 4:52636312-52636334 GTACCAGGCTGTGTTCTTCTGGG - Intronic
973774826 4:54233279-54233301 GGACCGCGCAGTGTTCCTCTGGG + Intronic
975218263 4:71782304-71782326 GAAGCTAGCTGTGTTCTTCCTGG - Intronic
976766742 4:88605952-88605974 AAACCACTCTGTGTTCCTGCTGG + Exonic
978521794 4:109623753-109623775 GAACAATGCTGAGGTCCTCCAGG - Intronic
986007543 5:3680733-3680755 GAACCACACTCTGTTCTTGCCGG - Intergenic
986972144 5:13349379-13349401 GCCCCAGGCTGTGTTGCTCCAGG + Intergenic
997366220 5:133326904-133326926 GAGGCAGGCTGAGTTCCTCCAGG - Intronic
1001658574 5:173373360-173373382 TATCCAGGCTGTGTTCCTTCTGG - Intergenic
1003113132 6:3265438-3265460 GACCCAAGCTGTGCCCCTCCAGG - Intronic
1003394360 6:5740641-5740663 GAAGCACGCTTTCTTCCTGCAGG - Intronic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1009033914 6:58093469-58093491 AAAACAAGCTGTGTTCCTCTGGG - Intergenic
1013536387 6:111066713-111066735 GGGCCACACTGTGTTCCACCAGG + Intergenic
1019100907 6:169628429-169628451 GTGACACGCTGTGTTCCTGCTGG - Intronic
1022185210 7:27960714-27960736 AAACCAGGCTTTGTTCCTCCAGG - Intronic
1024604312 7:51012008-51012030 GAATCACCCTGCGTTCCCCCAGG + Intergenic
1028320802 7:89458084-89458106 TAGCCACTCGGTGTTCCTCCGGG - Intergenic
1029555430 7:101265625-101265647 GGATCTCGCTGTGTTCCCCCAGG + Intergenic
1032071864 7:128812776-128812798 GCAGCTGGCTGTGTTCCTCCTGG - Exonic
1037885427 8:22593733-22593755 GAACCAGGCTGTGCGCATCCAGG + Exonic
1042974808 8:74456429-74456451 GAACCACACTGTTTTCCTATAGG - Intronic
1044466306 8:92510751-92510773 GAGCCACACTGTCTTCCTCTTGG - Intergenic
1045146313 8:99348111-99348133 GAACCAGGCTCTGATCCTCTTGG - Intronic
1045955507 8:107901101-107901123 GGAAGACGCTGTGTTGCTCCTGG + Exonic
1047349528 8:124060430-124060452 GAACCACGCTGTGTTCCTCCAGG - Intronic
1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG + Intronic
1055913918 9:81380802-81380824 CAATAACGCTGTGTCCCTCCGGG + Intergenic
1061864997 9:133487625-133487647 AAACCACGCTTTGTCCTTCCTGG + Intergenic
1203784526 EBV:120026-120048 GGACCACGCCATCTTCCTCCCGG + Intergenic
1186446713 X:9635926-9635948 GAACCACGTTGTGTTTTTCCAGG - Intronic
1190339786 X:49287030-49287052 GAACAGCGGTGTGTCCCTCCTGG + Exonic
1190442437 X:50488527-50488549 AAACCACTCTGTTTTTCTCCTGG - Intergenic
1193706899 X:84832192-84832214 GAACCACCCTCTGTTCCTAAGGG - Intergenic
1200758814 Y:7016972-7016994 GGACCGCACTGTGTTTCTCCAGG - Intronic
1201234613 Y:11897206-11897228 CAACCTAGCTGTGTTCCTTCAGG - Intergenic