ID: 1047355653

View in Genome Browser
Species Human (GRCh38)
Location 8:124119285-124119307
Sequence AAGTCTTTCCTGACAGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 250}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047355653_1047355659 11 Left 1047355653 8:124119285-124119307 CCTGAGGCTGTCAGGAAAGACTT 0: 1
1: 0
2: 2
3: 20
4: 250
Right 1047355659 8:124119319-124119341 TGGGATTTGAGCTGGCAGGTTGG No data
1047355653_1047355657 3 Left 1047355653 8:124119285-124119307 CCTGAGGCTGTCAGGAAAGACTT 0: 1
1: 0
2: 2
3: 20
4: 250
Right 1047355657 8:124119311-124119333 AGAAAAGGTGGGATTTGAGCTGG No data
1047355653_1047355663 26 Left 1047355653 8:124119285-124119307 CCTGAGGCTGTCAGGAAAGACTT 0: 1
1: 0
2: 2
3: 20
4: 250
Right 1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG No data
1047355653_1047355664 29 Left 1047355653 8:124119285-124119307 CCTGAGGCTGTCAGGAAAGACTT 0: 1
1: 0
2: 2
3: 20
4: 250
Right 1047355664 8:124119337-124119359 GTTGGACAGATGGAGGGTGGTGG No data
1047355653_1047355661 22 Left 1047355653 8:124119285-124119307 CCTGAGGCTGTCAGGAAAGACTT 0: 1
1: 0
2: 2
3: 20
4: 250
Right 1047355661 8:124119330-124119352 CTGGCAGGTTGGACAGATGGAGG No data
1047355653_1047355662 23 Left 1047355653 8:124119285-124119307 CCTGAGGCTGTCAGGAAAGACTT 0: 1
1: 0
2: 2
3: 20
4: 250
Right 1047355662 8:124119331-124119353 TGGCAGGTTGGACAGATGGAGGG No data
1047355653_1047355660 19 Left 1047355653 8:124119285-124119307 CCTGAGGCTGTCAGGAAAGACTT 0: 1
1: 0
2: 2
3: 20
4: 250
Right 1047355660 8:124119327-124119349 GAGCTGGCAGGTTGGACAGATGG No data
1047355653_1047355655 -9 Left 1047355653 8:124119285-124119307 CCTGAGGCTGTCAGGAAAGACTT 0: 1
1: 0
2: 2
3: 20
4: 250
Right 1047355655 8:124119299-124119321 GAAAGACTTCATAGAAAAGGTGG No data
1047355653_1047355665 30 Left 1047355653 8:124119285-124119307 CCTGAGGCTGTCAGGAAAGACTT 0: 1
1: 0
2: 2
3: 20
4: 250
Right 1047355665 8:124119338-124119360 TTGGACAGATGGAGGGTGGTGGG No data
1047355653_1047355656 -8 Left 1047355653 8:124119285-124119307 CCTGAGGCTGTCAGGAAAGACTT 0: 1
1: 0
2: 2
3: 20
4: 250
Right 1047355656 8:124119300-124119322 AAAGACTTCATAGAAAAGGTGGG No data
1047355653_1047355658 7 Left 1047355653 8:124119285-124119307 CCTGAGGCTGTCAGGAAAGACTT 0: 1
1: 0
2: 2
3: 20
4: 250
Right 1047355658 8:124119315-124119337 AAGGTGGGATTTGAGCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047355653 Original CRISPR AAGTCTTTCCTGACAGCCTC AGG (reversed) Intronic
900506980 1:3034618-3034640 GAGTCTTTCCTGCAAACCTCTGG - Intergenic
900830929 1:4964895-4964917 AAGTCCTTAATCACAGCCTCAGG + Intergenic
902488299 1:16762512-16762534 AATTCTATCCTGAGAGCCACAGG - Intronic
903018327 1:20376313-20376335 AAGCCTTCCCAGACACCCTCAGG - Intergenic
904163404 1:28537427-28537449 AAGTCTTCCCAGATAACCTCAGG - Intronic
905081566 1:35326612-35326634 AAGCCTATCCTGGCAGCCTCAGG + Intronic
906963067 1:50431109-50431131 AACTCTTTCCTGGCAGGGTCGGG + Intergenic
907383311 1:54109175-54109197 AAACCTTTCCTGATACCCTCCGG - Intronic
908446818 1:64206325-64206347 AAGACATTCCTGACTCCCTCAGG - Intronic
909609225 1:77535488-77535510 AAGCCTTTCCTGACCACCTGAGG - Intronic
911198544 1:95020377-95020399 TAGTGTTTTCTAACAGCCTCTGG - Intronic
911737056 1:101349165-101349187 AAGCCTTTTCTGACACCTTCAGG + Intergenic
912101843 1:106217681-106217703 AAGTATTTCCTTCCAGTCTCTGG - Intergenic
912510525 1:110186837-110186859 AAGTTTTTCCTAATTGCCTCTGG - Intronic
913182688 1:116337274-116337296 AAGTCATTCCTCATAGCCTTTGG - Intergenic
913614512 1:120544633-120544655 AGGTCTTTACTGACACCTTCAGG - Intergenic
914492820 1:148162746-148162768 AACTCTTTCCAGACAGACTCCGG + Intergenic
916705280 1:167342936-167342958 AAGCATTTCCAGAGAGCCTCAGG + Intronic
918072294 1:181141814-181141836 TGGTCATTCCTGAGAGCCTCGGG - Intergenic
918793808 1:188865633-188865655 CAGTCTTTACTGACAGGCACAGG + Intergenic
919787219 1:201266968-201266990 AAGTCTTGCCTGAATGCCTGTGG + Intergenic
921110855 1:212035397-212035419 AAGTCTTTCCTGGCAGATGCCGG - Exonic
1063167946 10:3480721-3480743 AAGTCTTTACTAAGAGCCTGTGG - Intergenic
1069012967 10:63394932-63394954 AAGTATTTCCTTACAGTCTGTGG - Intronic
1069075791 10:64037188-64037210 ACAACTTTCCTGACAGCTTCAGG - Intergenic
1069306338 10:66975480-66975502 AAGCTTTTCCTGAAATCCTCAGG - Intronic
1069371365 10:67750917-67750939 AAGTCTATCCGGAGAGCCTAGGG - Intergenic
1070584071 10:77747856-77747878 AAGACCTTCCTCAAAGCCTCAGG + Intergenic
1070841069 10:79488285-79488307 AAATCTTCCCTGACAGCCATGGG - Intergenic
1073729327 10:106270939-106270961 AAGACTGTCCTGACAGCATGAGG + Intergenic
1074706409 10:116136728-116136750 AACTCTTTCCTGGAAGCCTGAGG + Intronic
1074820330 10:117173679-117173701 AAGCCTTTCCAGACATCCCCAGG + Intergenic
1075038008 10:119085461-119085483 AAGCTTTTCCTGACAGCCAGGGG + Intergenic
1076279471 10:129233455-129233477 AAGTCTGTCCTGCCAGGCTCAGG - Intergenic
1077386594 11:2272129-2272151 CAGTGTTTACTGCCAGCCTCGGG + Intergenic
1077902121 11:6497957-6497979 GAGCCTTTCCTGAGACCCTCAGG - Exonic
1078426016 11:11252054-11252076 AAGCCTTCTCTGACACCCTCAGG - Intergenic
1078603474 11:12754581-12754603 AACTCTTTCCTGTCAACCTAAGG - Intronic
1079300055 11:19269988-19270010 AAGTCTTTCTTTACAACTTCAGG + Intergenic
1080441628 11:32299846-32299868 AAGTGTTTACTGCCAGCCCCTGG - Intergenic
1083605282 11:63974985-63975007 AGGTCTTTCCCCACAGCCCCAGG + Intronic
1085277171 11:75307623-75307645 AAGTCTGTCCTGGGAGCTTCTGG - Intronic
1087948973 11:104196676-104196698 AAATATTTCCTGACATCTTCAGG + Intergenic
1088780652 11:113131149-113131171 AAGAATTTCCTGACAGCAGCTGG - Intronic
1089142459 11:116296919-116296941 AAGTCTTACCTGACAGGCCAGGG - Intergenic
1091451815 12:576712-576734 CAGTCTTTTCTGAAAGCCACTGG - Intronic
1091550661 12:1532548-1532570 ATGTCTCTCCTGACTGCCTTTGG - Intronic
1092137978 12:6162883-6162905 CTGTCTTTCCTGAAAGCTTCTGG - Intergenic
1092848088 12:12602738-12602760 AAGTCTTTACCGGCAGCCTGAGG + Intergenic
1093826476 12:23696408-23696430 AAGTTTTTCATAACAGCCCCTGG + Intronic
1096512960 12:52141982-52142004 AAGCCTTTCCCCACACCCTCTGG - Intergenic
1096607907 12:52779922-52779944 AGGTCTTTCCTCATATCCTCTGG + Intergenic
1097932211 12:65200735-65200757 AAATATTTCCTGACAGTCTATGG + Intronic
1097994787 12:65876747-65876769 AGAGCTTTCCAGACAGCCTCCGG + Intronic
1098193784 12:67978090-67978112 AGGTCTTTCCTTACGGTCTCTGG - Intergenic
1099076304 12:78113414-78113436 AAGCATTTCCTTACATCCTCTGG + Intronic
1099275924 12:80576120-80576142 AAGTTTTTCTTTACAGCCACAGG + Intronic
1100607828 12:96166190-96166212 AAGTCGTTCCTTTCTGCCTCTGG + Intergenic
1102285936 12:111656701-111656723 AAATCTTTGCTGTCAGCCACTGG - Intronic
1104030826 12:125065090-125065112 AGGTCTTTACTGAGAGCCTGCGG - Intergenic
1104808230 12:131603233-131603255 CAGTGTTTCCACACAGCCTCAGG + Intergenic
1104808252 12:131603313-131603335 CAGTGTTTCCACACAGCCTCGGG + Intergenic
1104833021 12:131767217-131767239 ATGTGTTTCCTGAAGGCCTCTGG - Intronic
1106888034 13:34211621-34211643 AAGTCTTACCCAACAGCCTTAGG - Intergenic
1107007582 13:35631946-35631968 AACTTTATCATGACAGCCTCTGG + Intronic
1107291536 13:38859936-38859958 AAGCCTTTCCTGACCCACTCAGG - Intronic
1108044570 13:46371584-46371606 AGGTGTTTCCAGACAGCCACGGG - Intronic
1108171956 13:47750997-47751019 CAGTCCTTCCTGACATCCTTTGG + Intergenic
1110844879 13:80182890-80182912 AAGTCTTTTCAGACAGCTTCAGG - Intergenic
1111247908 13:85565743-85565765 AAGTCTTTTCTGGCCGCCACTGG + Intergenic
1113979938 13:114266303-114266325 AGGTAATTTCTGACAGCCTCGGG - Intronic
1115388012 14:32820511-32820533 AAGACTTTCCTGACCACCCCAGG - Intronic
1115430462 14:33311803-33311825 CAGTCTTTCCTGTCATTCTCAGG - Intronic
1117771142 14:59135768-59135790 TTGGCTCTCCTGACAGCCTCTGG - Intergenic
1118760521 14:68878160-68878182 CAGTCCTTCCTGCCAGCCTCAGG + Intronic
1121485743 14:94313089-94313111 AAGTCTTTCCTGGGTGACTCTGG + Intronic
1122275293 14:100587750-100587772 AGGTCATTACTGACAGCCTCTGG - Intergenic
1123895408 15:24824154-24824176 GAGACTTTCCTGAGAGCCACAGG + Intronic
1124649094 15:31461933-31461955 AAGTCTTACCTTAAAGCCTTTGG + Intergenic
1125084429 15:35713853-35713875 GAGTGTTTTCTGACACCCTCCGG - Intergenic
1125151888 15:36541968-36541990 AAGTCTTTCCTGACACCTACAGG - Intergenic
1125204403 15:37136262-37136284 AAGTCTCTGCTGAGAGCCACAGG + Intergenic
1127094391 15:55498174-55498196 AAGTCTTGCCTGCCGGTCTCCGG - Intronic
1127153065 15:56098308-56098330 AAGTAATTCCTTTCAGCCTCAGG - Exonic
1129270811 15:74418364-74418386 AATGCTTTCCACACAGCCTCAGG + Intronic
1129432114 15:75506889-75506911 AAGTCTTTCCTGACTGCCTGAGG + Intronic
1130610163 15:85354002-85354024 AAGCCTTCCTTGACATCCTCAGG - Intergenic
1130848216 15:87767374-87767396 AATTCTTTCCTGTCAGCCAGTGG - Intergenic
1131825812 15:96322063-96322085 CAGTCTCTCCAGACAGCCTCGGG - Intergenic
1131962076 15:97800487-97800509 AAGACTTCCCTGACAGCTCCAGG + Intergenic
1132469834 16:96275-96297 AACTCCTGCCAGACAGCCTCAGG + Intronic
1134216383 16:12319978-12320000 AAGCCTTGCCTGACAGCTCCTGG + Intronic
1134591539 16:15458145-15458167 AAGACTTTCCTGACACCTACAGG + Intronic
1135136796 16:19890890-19890912 AAATGTTTCCTGACAGCTTTGGG - Intergenic
1136783170 16:32919886-32919908 AGGCCTACCCTGACAGCCTCTGG + Intergenic
1136886616 16:33933963-33933985 AGGCCTACCCTGACAGCCTCTGG - Intergenic
1137502069 16:49019341-49019363 AAGTTTTTCTTGCCAGCCTGGGG - Intergenic
1140247780 16:73267087-73267109 TACACTTTCGTGACAGCCTCAGG + Intergenic
1140861267 16:79020270-79020292 AAGTCTTCCATGACTGCCCCAGG - Intronic
1203085823 16_KI270728v1_random:1183871-1183893 AGGCCTACCCTGACAGCCTCTGG + Intergenic
1142771044 17:2097053-2097075 AAGTCTTTCTTGACTACTTCTGG + Intronic
1144827177 17:18112046-18112068 AAGTCCTGCCTCAAAGCCTCAGG - Intronic
1146780972 17:35671892-35671914 AACTCTTTACTTACAGCCTTAGG - Exonic
1147143431 17:38472067-38472089 AGGCCTACCCTGACAGCCTCTGG + Intronic
1148090408 17:45019718-45019740 AGGTCTTTCCTGAGCGCCACTGG + Intergenic
1148172452 17:45534066-45534088 CAGTTTTCCCTGACAGCCTTGGG - Intergenic
1148276817 17:46311387-46311409 CAGTTTTCCCTGACAGCCTTGGG + Intronic
1148298934 17:46528971-46528993 CAGTTTTCCCTGACAGCCTTGGG + Intronic
1148325958 17:46783670-46783692 AAGTGTGTCCTCACTGCCTCTGG + Intronic
1148363469 17:47033498-47033520 CAGTTTTCCCTGACAGCCTTGGG + Intronic
1149646078 17:58242594-58242616 AATTCTGCCCTGACAGCCTGTGG - Intronic
1150403659 17:64880982-64881004 CAGTTTTCCCTGACAGCCTTGGG - Intronic
1152473846 17:80504706-80504728 CAGTCTGTCCTGGAAGCCTCTGG - Intergenic
1154024566 18:10695432-10695454 AGCCCTTTCCTGACAGCTTCTGG + Intronic
1155345214 18:24850817-24850839 AAGCCTTTCCTGACTGCTCCAGG + Intergenic
1155550708 18:26962081-26962103 CAGTTTTTCCTGACACCCCCAGG - Intronic
1157188856 18:45563273-45563295 AAGTCTGTGCTGGCAGCCACAGG + Intronic
1157594937 18:48858718-48858740 AGGGCTCTCCTGACGGCCTCTGG + Intronic
1159007848 18:63028860-63028882 AAGTCTTTCCTGACATGCCTTGG + Intergenic
1159938597 18:74388447-74388469 AACACTTTCCTGGCAGCCTCAGG - Intergenic
1165764252 19:38340816-38340838 AATTCTTTCATGCCAGCCTTAGG - Intronic
1167695364 19:51012502-51012524 AAGCCTTTCCTGACTCCTTCAGG + Intergenic
1202702898 1_KI270713v1_random:1728-1750 AATTCTATCCTGAGAGCCACAGG + Intergenic
925248091 2:2402549-2402571 AAGTAATTCCTGATATCCTCAGG + Intergenic
925373250 2:3362551-3362573 ATTTCTTTCCTGTCAGACTCTGG + Intronic
926686260 2:15700260-15700282 AAATCTTCCCTGGGAGCCTCTGG - Intronic
926988075 2:18645819-18645841 AAGGCTTCATTGACAGCCTCAGG + Intergenic
927761178 2:25756025-25756047 GAGTCTTTCCTTCCAGCCTTGGG + Exonic
927816973 2:26227008-26227030 AAATATTTCCTCACAGTCTCTGG - Intronic
929937696 2:46306275-46306297 AGTTTTTTCCTGACTGCCTCTGG + Intronic
930202553 2:48558974-48558996 GAGTATTTCCTTTCAGCCTCAGG - Intronic
932968134 2:76502680-76502702 TACTCTTGCCTGACAGGCTCAGG - Intergenic
935092722 2:99911721-99911743 AAGTCTTTCCTTGCAGCCCCTGG - Intronic
935504169 2:103879333-103879355 AAGTCTCTCAAGACAGACTCTGG - Intergenic
937311315 2:120905131-120905153 CAGTCATTTCTGGCAGCCTCAGG + Intronic
937698378 2:124835450-124835472 AGGTCCATCCTGACAGCCTCTGG + Intronic
938562068 2:132481869-132481891 AAGTATTTCCTGACAAAATCAGG - Intronic
938752177 2:134343148-134343170 ATGTCTTTCCTGACCTCCCCAGG - Intronic
939468756 2:142592417-142592439 AAGTCTTACCTTCCATCCTCTGG + Intergenic
939745235 2:145959573-145959595 CAGTCTTCACTGACTGCCTCCGG + Intergenic
939896924 2:147802775-147802797 AAGCCTTCTCTGACACCCTCAGG - Intergenic
940660317 2:156537215-156537237 AAGTCAATCCTGGCAGCCCCTGG - Intronic
940838493 2:158552225-158552247 AGGTTTTTCCCTACAGCCTCTGG + Intronic
941030604 2:160507281-160507303 ATGTCTTTCCTGTCAGGCTCTGG + Intergenic
941173501 2:162168759-162168781 AAGCCTTCCCTGACCCCCTCAGG - Intergenic
941311145 2:163933806-163933828 AAGATTTTCCTGACATCCGCAGG - Intergenic
941856625 2:170237705-170237727 AAGTCTCTACTGCCTGCCTCGGG + Intronic
942103038 2:172605020-172605042 AAGTTTTCTCTGAGAGCCTCAGG - Intronic
942485234 2:176432269-176432291 AAGTTTTTCCTGTCATCCTTAGG + Intergenic
943979592 2:194531238-194531260 AAGTCTTTAGAGATAGCCTCTGG + Intergenic
944559978 2:200926894-200926916 CTGTCTTTCCTAACAGCCTTGGG - Exonic
945018847 2:205550538-205550560 AAGTTTTTCCTGACACCTCCAGG + Intronic
945506137 2:210642573-210642595 AAGTCTGTGCTCACAGTCTCAGG - Exonic
947089970 2:226498582-226498604 AAGTCTTCCCTGTGAGCCTCAGG - Intergenic
947094549 2:226551225-226551247 AAGGCTTCTCTGCCAGCCTCTGG + Intergenic
947585553 2:231354307-231354329 AAGACTTTCCTGCCCCCCTCAGG + Intronic
948216202 2:236235009-236235031 AAGTATTACCTGCCAGTCTCTGG - Intronic
1169381899 20:5114435-5114457 AAGTCTTTCTTCACAACTTCAGG + Intergenic
1170554795 20:17506233-17506255 AATTCTCCCCTAACAGCCTCTGG + Intronic
1170703352 20:18724074-18724096 AAGACTTTCCTGGAAGCCCCTGG + Intronic
1176671825 21:9741966-9741988 GAGTCTCTCCTGACAGCAGCAGG - Intergenic
1179448826 21:41453670-41453692 AACTGCATCCTGACAGCCTCAGG - Intronic
1179470695 21:41608176-41608198 AACTCTGTCCTGAAAACCTCTGG - Intergenic
1181587661 22:23862480-23862502 AAGTCCTTCCTAACTACCTCTGG + Intronic
1183469521 22:37998137-37998159 AAGCCTTTCCTTCCCGCCTCTGG + Intronic
949629983 3:5914381-5914403 TAGTCTTTACTGACAGCATGAGG + Intergenic
950150344 3:10681987-10682009 CAGCCTTCCCTGACTGCCTCAGG - Intronic
950353791 3:12385059-12385081 ATGTCTTTACTGACAGCCACTGG - Intronic
950634530 3:14305538-14305560 AAGTATTTCCTTCCAGCCTGAGG + Intergenic
950640837 3:14347064-14347086 ATGGCTTTCCTGACTGCCCCCGG - Intergenic
952002373 3:28801010-28801032 AAAACTTTCCTGACTCCCTCTGG + Intergenic
952020713 3:29016120-29016142 ATGTCTCTCCTGAAAGTCTCTGG + Intergenic
953538057 3:43790786-43790808 ATGTCTTTTCTGACAGCGTGGGG + Intergenic
953763242 3:45711121-45711143 AAGTTGTCCCTGACAACCTCAGG - Intronic
954933316 3:54303313-54303335 TAGTCTTTTCTGACAGTGTCAGG + Intronic
954995561 3:54878223-54878245 GAGCCTTTCCTGACAGGCTGTGG + Intronic
960181880 3:114589490-114589512 AAATCTTTCCTGACAACCTCAGG + Intronic
961178066 3:124852322-124852344 ACGTAATTCCTGCCAGCCTCAGG + Intronic
962167845 3:133068883-133068905 AAGCCTTTCCTGATGGCTTCTGG - Intronic
967648919 3:191961604-191961626 GAGTCTGTTCTGTCAGCCTCAGG - Intergenic
968790157 4:2654561-2654583 GACTCTCTCCTCACAGCCTCAGG - Intronic
969633465 4:8351832-8351854 ATGTCTTTTCTGCCAGCCTTCGG - Intergenic
971145621 4:23973273-23973295 AATTCTTTCCTGATTTCCTCAGG + Intergenic
971506229 4:27369229-27369251 AAGTGTTTCCTGCAAGCCCCTGG + Intergenic
972414701 4:38826965-38826987 AAGTCTTTCCTGAAGGCATGAGG + Exonic
975212032 4:71712145-71712167 CACTCTTTTCTGACAGCCTGCGG + Intergenic
975396262 4:73877352-73877374 AAGTCTTTCCTGACGGCCCTGGG + Intergenic
975976337 4:80101048-80101070 AAGTTTTCTCTGACATCCTCTGG + Intronic
976481309 4:85549563-85549585 AAATATTTTCTGACAGTCTCTGG + Intronic
977142536 4:93391702-93391724 AAGTCATTCCTTACAGCCCATGG + Intronic
977150527 4:93506274-93506296 AAGTCTACCCTGACAGACTTGGG - Intronic
978282830 4:107037232-107037254 AAGCCATTCCTGTCAGCCCCCGG + Intronic
978322371 4:107512082-107512104 AACTTTTTCCTCACAGCCTGAGG + Intergenic
980782596 4:137511164-137511186 AAGTCTTCACTGACAGGCTGGGG + Intergenic
981595798 4:146420386-146420408 AAGTTTTTCATGAAAGCTTCTGG - Intronic
982417228 4:155149541-155149563 ATTTCTTGCCTGACACCCTCAGG - Intergenic
983096778 4:163571833-163571855 AAGTCTTTCATGTATGCCTCAGG + Intronic
983394298 4:167173885-167173907 AAGCATTTCCTGAAACCCTCAGG - Intronic
984801798 4:183722951-183722973 AGGTCTCTCCTGCCAGCCTCAGG - Intergenic
986377654 5:7148661-7148683 ATGTCTCTCCTGACAGCCTTTGG + Intergenic
990725958 5:58754914-58754936 AAGCCTTTTCTGTCAGCCCCAGG + Intronic
990741729 5:58919425-58919447 AAGCCTTACCTGAAAGCCACTGG + Intergenic
991458557 5:66832135-66832157 ATGCCTTTCCTGCCATCCTCTGG + Intronic
994101195 5:95894503-95894525 CAGTCTTCCAGGACAGCCTCTGG - Intronic
995386934 5:111598694-111598716 ATGTCTTTCCTGACAGTGCCAGG + Intergenic
996576956 5:124986171-124986193 CATTCTTTCCTCCCAGCCTCTGG + Intergenic
999326041 5:150644275-150644297 AAGTCTCTGCTGACATACTCAGG - Intronic
1000244331 5:159436833-159436855 AGGTATTTCTTTACAGCCTCGGG + Intergenic
1000984447 5:167851526-167851548 AAATTTTCCCTGAAAGCCTCTGG + Intronic
1003983804 6:11416061-11416083 GATTCTTTCCTGAAATCCTCTGG + Intergenic
1004782948 6:18932398-18932420 AAGCCTTTCCTGACCTCCTCAGG - Intergenic
1005315038 6:24596252-24596274 AAGTCCTTTCTGATATCCTCAGG + Exonic
1006084317 6:31585640-31585662 AGGTCTCTCCAGAGAGCCTCAGG + Intergenic
1007388508 6:41535950-41535972 AAGTCTTCCCTGAATGCCCCAGG - Intergenic
1010103578 6:72140982-72141004 AAGTTTTTCCTGCCATCCTGTGG - Intronic
1010579761 6:77581057-77581079 AAGTCTCTTCTTCCAGCCTCAGG + Intergenic
1012105163 6:95148217-95148239 AAGTCTTTTCTGTCAGTCTTAGG + Intergenic
1012142389 6:95640105-95640127 ACCTCTTTCATGACAGTCTCTGG - Intergenic
1012602941 6:101120133-101120155 AACTGTTTTCTGAGAGCCTCTGG - Intergenic
1015834310 6:137403694-137403716 AAGACTTTCATGACTGCTTCAGG + Intergenic
1015952209 6:138564816-138564838 AAGTCTTCTCTAACATCCTCAGG - Intronic
1018338845 6:162827854-162827876 AAGTCTTTCCTGACTTTCCCAGG + Intronic
1019145781 6:169974806-169974828 AAGGCATTCCTGCAAGCCTCGGG + Intergenic
1019792720 7:3027444-3027466 AGGTCTTTCCTGACTCCTTCAGG + Intronic
1020342628 7:7128845-7128867 AAGTCTCTCATTTCAGCCTCTGG - Intergenic
1020999294 7:15308084-15308106 AAATGTTTCCTGGCAGCCTGTGG - Intronic
1021842342 7:24731078-24731100 ATGTCTTTCCTGAGACCCCCAGG - Intronic
1022658426 7:32343090-32343112 AAGTCCTTGTTGGCAGCCTCTGG - Intergenic
1023795955 7:43792326-43792348 AAATCTTTTCAGACTGCCTCAGG + Intronic
1026450393 7:70524263-70524285 AAGTATTTCCTCAAAGCCTGGGG + Intronic
1026822081 7:73556892-73556914 AGGACTCTCCTGACAGCCGCCGG + Intronic
1030082295 7:105788478-105788500 AAGACTTTACCCACAGCCTCAGG + Intronic
1030465658 7:109900633-109900655 AATTCTTTCCTGACATCCCTGGG + Intergenic
1030567666 7:111179890-111179912 AGTTCATTCCTGACAGCTTCAGG - Intronic
1032466906 7:132151756-132151778 GCTTCTTTCCTGAAAGCCTCAGG - Intronic
1033666329 7:143444128-143444150 AAGGCTCTCCTTACAACCTCAGG + Exonic
1034223857 7:149467395-149467417 AAGTCTTTTCTGGCAGTCTTAGG + Intergenic
1034721353 7:153296659-153296681 AAGTGGTTCCAGACAGACTCTGG + Intergenic
1034740388 7:153467994-153468016 AATTGTTTACTGACAGTCTCAGG + Intergenic
1035600355 8:893603-893625 AAGACCCTCCTGACAGCTTCCGG - Intergenic
1035939066 8:3875620-3875642 CAGAGTTTCCTCACAGCCTCCGG + Intronic
1037847630 8:22297813-22297835 AGGCCTTTCCTGAGAGCCTATGG - Intronic
1039843128 8:41307799-41307821 CAGACTTTCCTAACAGCCTGAGG - Intronic
1040856824 8:51957206-51957228 AAATCTTTTCTCACAGCATCTGG - Intergenic
1042125148 8:65530744-65530766 AAGTCTATTCTCACAGACTCTGG + Intergenic
1042285573 8:67106658-67106680 AAGTCTCTCCTCACAGTTTCTGG - Intronic
1043570604 8:81598778-81598800 AAGCCTTTCCTGACAACCCAAGG - Intergenic
1044448185 8:92302481-92302503 GAGTCTTCCCTGACCGCCCCTGG + Intergenic
1047355653 8:124119285-124119307 AAGTCTTTCCTGACAGCCTCAGG - Intronic
1047357496 8:124137482-124137504 GAGTATTTCCTGACAGCCCCAGG - Intergenic
1047904278 8:129456324-129456346 AAGTCTTCTCTGACACTCTCAGG + Intergenic
1048205667 8:132413397-132413419 AAGCCTTCCCTGACTGCCTCAGG + Intronic
1049994723 9:1024336-1024358 AAGACCTTCATGAGAGCCTCAGG + Intergenic
1052953965 9:34237998-34238020 AAGTCACTCCCCACAGCCTCTGG + Intronic
1059347298 9:113637703-113637725 AAGTCTTCCTTGATTGCCTCGGG + Intergenic
1060034596 9:120244017-120244039 CAGCCCTTCCTGACATCCTCAGG - Intergenic
1062110599 9:134780149-134780171 AAGTCTCTCCTTGCAGCCACGGG + Intronic
1185545537 X:941010-941032 GAGCTTTTCCTGACAGCTTCGGG - Intergenic
1187152369 X:16693098-16693120 AAGTCTATCCTGAAGGTCTCTGG - Intronic
1187761005 X:22584746-22584768 AAGTCTATCCTGAAAGAATCAGG + Intergenic
1187962481 X:24579818-24579840 AAGTCTTTTCTGACGTCATCAGG + Intronic
1187984974 X:24800343-24800365 AAATCTTTGCTGACAGTTTCAGG + Intronic
1194120588 X:89958999-89959021 AAGACTTTCTTGAAAGCCTATGG + Intergenic
1194927886 X:99848587-99848609 AAGTTTTTCCTAACAGCAGCAGG + Intergenic
1195712663 X:107786513-107786535 GAGTCTTTCTGGAGAGCCTCCGG - Intronic
1198226663 X:134651809-134651831 AAGTCCTGCCTGAGACCCTCAGG + Intronic
1198256047 X:134925432-134925454 GATTTTGTCCTGACAGCCTCTGG - Intergenic
1199591088 X:149469088-149469110 ATATATTTCCTGACATCCTCAGG - Intergenic
1200061800 X:153487120-153487142 ATCTCTTTGCTGACAGTCTCAGG - Intronic
1200473451 Y:3616504-3616526 AAGACTTTCTTGAAAGCCTATGG + Intergenic
1201304895 Y:12541911-12541933 CACTCTGTGCTGACAGCCTCGGG + Intergenic
1201365395 Y:13200307-13200329 TAGTCTTTCTTGACACCCTTTGG - Intergenic
1202139238 Y:21703785-21703807 CAGTGTTACCTGAAAGCCTCAGG + Intergenic